Knowledge (XXG)

Telomere

Source 📝

526:(ROS), can lead to DNA damage; however, it is yet unclear whether the elevated rate in telomeres is brought about by their inherent susceptibility or a diminished activity of DNA repair systems in these regions. Despite widespread agreement of the findings, widespread flaws regarding measurement and sampling have been pointed out; for example, a suspected species and tissue dependency of oxidative damage to telomeres is said to be insufficiently accounted for. Population-based studies have indicated an interaction between anti-oxidant intake and telomere length. In the Long Island Breast Cancer Study Project (LIBCSP), authors found a moderate increase in breast cancer risk among women with the shortest telomeres and lower dietary intake of beta carotene, vitamin C or E. These results suggest that cancer risk due to telomere shortening may interact with other mechanisms of DNA damage, specifically oxidative stress. 305:). The last primer to be involved in lagging-strand replication sits near the 3'-end of the template (corresponding to the potential 5'-end of the lagging-strand). Originally it was believed that the last primer would sit at the very end of the template, thus, once removed, the DNA-polymerase that substitutes primers with DNA (DNA-Pol δ in eukaryotes) would be unable to synthesize the "replacement DNA" from the 5'-end of the lagging strand so that the template nucleotides previously paired to the last primer would not be replicated. It has since been questioned whether the last lagging strand primer is placed exactly at the 3'-end of the template and it was demonstrated that it is rather synthesized at a distance of about 70–100 nucleotides which is consistent with the finding that DNA in cultured human cell is shortened by 50–100 426: 219:
that determines the number of divisions that a certain cell clone can undergo. Furthermore, it was predicted that a specialized DNA polymerase (originally called a tandem-DNA-polymerase) could extend telomeres in immortal tissues such as germ line, cancer cells and stem cells. It also followed from this hypothesis that organisms with circular genome, such as bacteria, do not have the end replication problem and therefore do not age.
585: 4990: 5489: 1284:
across vertebrates. Phylogeny and life history traits such as body size or the pace of life can also affect telomere dynamics. For example, it has been described across species of birds and mammals. In 2019, a meta-analysis confirmed that the exposure to stressors (e.g. pathogen infection, competition, reproductive effort and high activity level) was associated with shorter telomeres across different animal taxa.
1307: 276: 1122: 1214: 5501: 576:. The literature concerning telomeres as integrative biomarkers of exposure to stress and adversity is dominated by cross-sectional and correlational studies, which makes causal interpretation problematic. A 2020 review argued that the relationship between psychosocial stress and telomere length appears strongest for stress experienced in utero or early life. 1255:(WGS) experiments. Amongst these are TelSeq, Telomerecat and telomereHunter. Length estimation from WGS typically works by differentiating telomere sequencing reads and then inferring the length of telomere that produced that number of reads. These methods have been shown to correlate with preexisting methods of estimation such as PCR and TRF. 359: 42: 612:, that tied telomere shortening with the Hayflick limit. The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in 301:) then being excised and substituted by DNA. The lagging strand, however, is oriented 3'-5' with respect to the replication fork so continuous replication by DNA-polymerase is impossible, which necessitates discontinuous replication involving the repeated synthesis of primers further 5' of the site of initiation (see 636:
A study reported that telomere length of different mammalian species correlates inversely rather than directly with lifespan, and concluded that the contribution of telomere length to lifespan remains controversial. There is little evidence that, in humans, telomere length is a significant biomarker
372:
At the very 3'-end of the telomere there is a 300 base pair overhang which can invade the double-stranded portion of the telomere forming a structure known as a T-loop. This loop is analogous to a knot, which stabilizes the telomere, and prevents the telomere ends from being recognized as breakpoints
1283:
estimates vary greatly within and among species. Age and telomere length often negatively correlate in vertebrates, but this decline is variable among taxa and linked to the method used for estimating telomere length. In contrast, the available information shows no sex differences in telomere length
316:
If coding sequences are degraded in this process, potentially vital genetic code would be lost. Telomeres are non-coding, repetitive sequences located at the termini of linear chromosomes to act as buffers for those coding sequences further behind. They "cap" the end-sequences and are progressively
218:
division, Olovnikov suggested that DNA sequences are lost every time a cell replicates until the loss reaches a critical level, at which point cell division ends. According to his theory of marginotomy, DNA sequences at the ends of telomeres are represented by tandem repeats, which create a buffer
439:
Many organisms have a ribonucleoprotein enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase "replenishes" the telomere "cap" and requires no ATP. In most multicellular eukaryotic organisms, telomerase is active only in
488:
ranging from 75 to 300 bases, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified. These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or
373:
by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion would result. The T-loop is maintained by several proteins, collectively referred to as the shelterin complex. In humans, the shelterin complex consists of six proteins identified as
493:. At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA, and base pairing to one of the two strands. This triple-stranded structure is called a 468:. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions. 195:, working with maize. Muller observed that the ends of irradiated fruit fly chromosomes did not present alterations such as deletions or inversions. He hypothesized the presence of a protective cap, which he coined "telomeres", from the Greek 552:
Telomere shortening is associated with aging, mortality, and aging-related diseases in experimental animals. Although many factors can affect human lifespan, such as smoking, diet, and exercise, as persons approach the upper limit of human
417:) to form such G-quadruplexes that accommodate it, rather than a T-loop. G-quadruplexes present an obstacle for enzymes such as DNA-polymerases and are thus thought to be involved in the regulation of replication and transcription. 409:, a special conformation of DNA involving non-Watson-Crick base pairing. There are different subtypes depending on the involvement of single- or double-stranded DNA, among other things. There is evidence for the 3'-overhang in 1239:
Several techniques are currently employed to assess average telomere length in eukaryotic cells. One method is the Terminal Restriction Fragment (TRF) southern blot. There is a Web-based Analyser of the Length of Telomeres
296:
to initiate replication. On the leading strand (oriented 5'-3' within the replication fork), DNA-polymerase continuously replicates from the point of initiation all the way to the strand's end with the primer (made of
540:
Although telomeres shorten during the lifetime of an individual, it is telomere shortening-rate rather than telomere length that is associated with the lifespan of a species. Critically short telomeres trigger a
1274:
During the last two decades, eco-evolutionary studies have investigated the relevance of life-history traits and environmental conditions on telomeres of wildlife. Most of these studies have been conducted in
291:
of the parent strands. This is a consequence of its unidirectional mode of DNA synthesis: it can only attach new nucleotides to an existing 3'-end (that is, synthesis progresses 5'-3') and thus it requires a
3462:
Fajkus, Petr; Adámik, Matej; Nelson, Andrew D L; Kilar, Agata M; Franek, Michal; Bubeník, Michal; Frydrychová, Radmila Čapková; Votavová, Alena; Sýkorová, Eva; Fajkus, Jiří; Peška, Vratislav (2023-01-11).
2023:
Lanza RP, Cibelli JB, Blackwell C, Cristofalo VJ, Francis MK, Baerlocher GM, et al. (April 2000). "Extension of cell life-span and telomere length in animals cloned from senescent somatic cells".
1259:
is used to quantify the length of telomeres in human white blood cells. A semi-automated method for measuring the average length of telomeres with Flow FISH was published in Nature Protocols in 2006.
346:), however, are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and function. The known structures of bacterial telomeres take the form of 5474: 1689:
Olovnikov AM (September 1973). "A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon".
4913: 1262:
While multiple companies offer telomere length measurement services, the utility of these measurements for widespread clinical or personal use has been questioned. Nobel Prize winner
1248:
assay for telomere length involves determining the Telomere-to-Single Copy Gene (T/S) ratio, which is demonstrated to be proportional to the average telomere length in a cell.
1132: 3111:
Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu CP, Morin GB, et al. (January 1998). "Extension of life-span by introduction of telomerase into normal human cells".
2755: 243: 1291:, and other non-mammalian organisms, show that there is no single universal model of telomere erosion; rather, there is wide variation in relevant dynamics across 3269:
Harris SE, Martin-Ruiz C, von Zglinicki T, Starr JM, Deary IJ (July 2012). "Telomere length and aging biomarkers in 70-year-olds: the Lothian Birth Cohort 1936".
210:
first recognized that chromosomes could not completely replicate their ends; this is known as the "end replication problem". Building on this, and accommodating
4414: 592:
is the theoretical limit to the number of times a cell may divide until the telomere becomes so short that division is inhibited and the cell enters senescence.
535: 5539: 1522:"A theory of marginotomy: The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon" 588:
The average cell will divide between 50 and 70 times before cell death. As the cell divides the telomeres on the end of the chromosome get smaller. The
320:
The "end replication problem" is exclusive to linear chromosomes as circular chromosomes do not have ends lying without reach of DNA-polymerases. Most
1228: 572:
was associated with a small decrease in telomere length—but that these associations attenuate to no significant association when accounting for
549:. Mice have much longer telomeres, but a greatly accelerated telomere shortening-rate and greatly reduced lifespan compared to humans and elephants. 4979: 4946: 4133:
Remot, Florentin; Ronget, Victor; Froy, Hannah; Rey, Benjamin; Gaillard, Jean-Michel; Nussey, Daniel H.; Lemaître, Jean-François (November 2020).
3877:
Baerlocher GM, Vulto I, de Jong G, Lansdorp PM (December 2006). "Flow cytometry and FISH to measure the average length of telomeres (flow FISH)".
3312:
Lyčka, Martin; Bubeník, Michal; Závodník, Michal; Peska, Vratislav; Fajkus, Petr; Demko, Martin; Fajkus, Jiří; Fojtová, Miloslava (2023-08-21).
645:
Experimentally verified and predicted telomere sequence motifs from more than 9000 species are collected in research community curated database
5155: 4068:
Remot, Florentin; Ronget, Victor; Froy, Hannah; Rey, Benjamin; Gaillard, Jean-Michel; Nussey, Daniel H.; Lemaitre, Jean-François (2021-09-07).
1633:
Blackburn EH, Gall JG (March 1978). "A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena".
4903: 4544: 1734:"Early and late steps in telomere overhang processing in normal human cells: the position of the final RNA primer drives telomere shortening" 246: 4908: 2794:"Divergence of sperm and leukocyte age-dependent telomere dynamics: implications for male-driven evolution of telomere length in humans" 5725: 5712: 3371:"Characterisation of an unusual telomere motif (TTTTTTAGGG)n in the plant Cestrum elegans (Solanaceae), a species with a large genome" 288: 6038: 5735: 4407: 3612:
Lyčka, Martin; Peska, Vratislav; Demko, Martin; Spyroglou, Ioannis; Kilar, Agata; Fajkus, Jiří; Fojtová, Miloslava (December 2021).
1794: 3060:
Feng J, Funk WD, Wang SS, Weinrich SL, Avilion AA, Chiu CP, et al. (September 1995). "The RNA component of human telomerase".
2646:"Perceived stress and telomere length: A systematic review, meta-analysis, and methodologic considerations for advancing the field" 3222:"Comparative biology of mammalian telomeres: hypotheses on ancestral states and the roles of telomeres in longevity determination" 2947:
Rentscher KE, Carroll JE, Mitchell C (April 2020). "Psychosocial Stressors and Telomere Length: A Current Review of the Science".
5532: 5464: 5186: 1819: 3569:
Rufer N, et al. (August 1998). "Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry".
5469: 1371: 234:, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. Blackburn, 5766: 5612: 5599: 5313: 5080: 4529: 457: 4400: 4208:"On the comparative biology of mammalian telomeres: Telomere length co-evolves with body mass, lifespan and cancer risk" 625:
demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of
350:
bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.
31: 1193: 1140: 5303: 4939: 618:
to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.
1165: 6033: 5883: 5525: 5160: 1330: 293: 1151: 1136: 425: 5771: 4974: 4676: 1245: 983: 35: 1172: 5505: 5330: 5009: 4969: 4730: 4514: 1361: 1087: 1001: 490: 2343:"Characterization of the yeast telomere nucleoprotein core: Rap1 binds independently to each recognition site" 4094: 2892:"Telomeres as integrative markers of exposure to stress and adversity: a systematic review and meta-analysis" 1015: 132: 115: 6048: 5577: 5552: 5517: 5226: 5004: 1252: 736: 626: 523: 187: 1669:"Elizabeth H. Blackburn, Carol W. Greider, Jack W. Szostak: The Nobel Prize in Physiology or Medicine 2009" 1075: 6007: 5935: 5828: 5493: 5398: 5383: 5211: 5105: 5085: 4932: 4683: 4666: 4636: 4609: 1179: 108: 1241: 5853: 5803: 4671: 4569: 3771:"Telomerecat: A ploidy-agnostic method for estimating telomere length from whole genome sequencing data" 3412:"Allium telomeres unmasked: the unusual telomeric sequence (CTCGGTTATGGG)n is synthesized by telomerase" 1668: 658: 485: 182: 5863: 1279:, i.e. birds and mammals. They have provided evidence for the inheritance of telomere length; however, 633:) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres. 5985: 5903: 1223:
Preliminary research indicates that disease risk in aging may be associated with telomere shortening,
460:. The steady shortening of telomeres with each replication in somatic (body) cells may have a role in 181:
The existence of a special structure at the ends of chromosomes was independently proposed in 1938 by
6028: 5980: 5893: 5808: 5694: 5556: 5423: 5286: 5150: 5100: 4891: 4816: 4801: 4631: 4579: 4554: 4494: 4146: 3782: 3614:"WALTER: an easy way to online evaluate telomere lengths from terminal restriction fragment analysis" 3178: 3120: 3069: 2903: 2299: 2087: 2032: 1893: 1698: 1533: 1345: 1161: 1099: 1063: 965: 868: 569: 449: 5758: 5629: 5308: 5291: 5271: 5251: 4559: 4368: 2704: 1263: 820: 546: 223: 170: 6043: 5930: 5838: 5813: 5657: 5318: 5064: 4294: 4188: 4115: 3964: 3902: 3594: 3441: 3294: 3202: 3144: 3093: 2990:
Hayflick L, Moorhead PS (December 1961). "The serial cultivation of human diploid cell strains".
2972: 2423: 2323: 2254: 2056: 1612: 1448: 1051: 796: 192: 3410:
Fajkus P, Peška V, Sitová Z, Fulnečková J, Dvořáčková M, Gogela R, et al. (February 2016).
1266:, who was co-founder of one company, promoted the clinical utility of telomere length measures. 2274:
Telomeric 8-oxo-guanine drives rapid premature senescence in the absence of telomere shortening
5908: 5443: 5438: 5393: 5216: 5090: 4621: 4533: 4343: 4286: 4278: 4237: 4229: 4180: 4162: 4107: 4099: 4050: 4032: 3956: 3894: 3859: 3808: 3751: 3702: 3653: 3635: 3586: 3551: 3502: 3484: 3433: 3392: 3351: 3333: 3286: 3251: 3194: 3136: 3085: 3042: 3007: 2964: 2929: 2872: 2823: 2774: 2731: 2675: 2623: 2574: 2521: 2472: 2415: 2374: 2315: 2290:
Shampay J, Szostak JW, Blackburn EH (1984). "DNA sequences of telomeres maintained in yeast".
2246: 2205: 2164: 2123: 2105: 2074:
Whittemore, Kurt; Vera, Elsa; Martínez-Nevado, Eva; Sanpera, Carola; Blasco, Maria A. (2019).
2048: 2005: 1956: 1921: 1862: 1800: 1790: 1763: 1714: 1650: 1604: 1596: 1557: 1549: 1502: 1494: 1440: 1432: 1340: 936: 713: 614: 605: 494: 5873: 5823: 5818: 4070:"Decline in telomere length with increasing age across nonhuman vertebrates: A meta-analysis" 3828:"TelomereHunter–in silico estimation of telomere content and composition from cancer genomes" 2960: 324:, relying on circular chromosomes, accordingly do not possess telomeres. A small fraction of 5992: 5922: 5848: 5798: 5560: 5373: 5340: 5095: 4811: 4710: 4333: 4325: 4268: 4219: 4170: 4154: 4089: 4081: 4040: 4024: 3991: 3948: 3886: 3849: 3839: 3798: 3790: 3741: 3733: 3692: 3684: 3643: 3625: 3578: 3541: 3533: 3492: 3476: 3423: 3382: 3341: 3325: 3278: 3241: 3233: 3220:
Gomes NM, Ryder OA, Houck ML, Charter SJ, Walker W, Forsyth NR, et al. (October 2011).
3186: 3128: 3077: 3034: 2999: 2956: 2919: 2911: 2862: 2854: 2813: 2805: 2764: 2721: 2713: 2665: 2657: 2613: 2605: 2564: 2556: 2511: 2503: 2462: 2454: 2405: 2364: 2354: 2307: 2236: 2195: 2154: 2113: 2095: 2040: 1995: 1987: 1948: 1939:
Lipps HJ, Rhodes D (August 2009). "G-quadruplex structures: in vivo evidence and function".
1911: 1901: 1852: 1753: 1745: 1706: 1642: 1588: 1541: 1424: 1320: 1039: 1027: 948: 597: 573: 515: 453: 211: 207: 60: 5843: 5748: 4866: 4861: 4257:"The association between stressors and telomeres in non-human vertebrates: a meta-analysis" 2792:
Aston KI, Hunt SC, Susser E, Kimura M, Factor-Litvak P, Carrell D, Aviv A (November 2012).
2392:
Griffith JD, Comeau L, Rosenfield S, Stansel RM, Bianchi A, Moss H, de Lange T (May 1999).
518:
and that oxidative stress-mediated DNA damage has a major influence on telomere shortening
5868: 5703: 5675: 5644: 5639: 5206: 5201: 5191: 4703: 4524: 4472: 3921: 3369:
Peška V, Fajkus P, Fojtová M, Dvořáčková M, Hapala J, Dvořáček V, et al. (May 2015).
2592:
Shen J, Gammon MD, Terry MB, Wang Q, Bradshaw P, Teitelbaum SL, et al. (April 2009).
880: 609: 554: 484:-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 270: 227: 165:
from progressive degradation and ensure the integrity of linear chromosomes by preventing
3282: 4318:
Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences
4150: 3786: 3522:"Human telomeres contain at least three types of G-rich repeat distributed non-randomly" 3464: 3346: 3182: 3124: 3073: 3025:
Hayflick L (March 1965). "The limited in vitro lifetime of human diploid cell strains".
2907: 2303: 2091: 2036: 1897: 1702: 1537: 5975: 5833: 5790: 5618: 5608: 5378: 5355: 5261: 5256: 5196: 5181: 5145: 5030: 4594: 4518: 4338: 4313: 4175: 4045: 3854: 3827: 3803: 3770: 3746: 3721: 3648: 3613: 3497: 3246: 3221: 2924: 2891: 2867: 2842: 2818: 2793: 2726: 2699: 2670: 2645: 2618: 2593: 2569: 2540: 2516: 2491: 2467: 2442: 2369: 2342: 2200: 2183: 2118: 2075: 2000: 1975: 1783: 1758: 1733: 1312: 1224: 695: 604:. Significant discoveries were subsequently made by a group of scientists organized at 601: 589: 302: 284: 231: 4989: 4383: 4374: 4371:, which includes a reference to the impact of stress, and pessimism on telomere length 4364: 3697: 3672: 3546: 3521: 3314:"TeloBase: a community-curated database of telomere sequences across the tree of life" 2410: 2393: 1916: 1881: 1521: 1186: 6022: 5940: 5680: 5603: 5594: 5586: 5276: 5231: 5140: 4955: 4574: 4378: 4298: 4192: 4119: 3445: 3237: 3190: 3038: 3003: 2976: 2273: 1857: 1840: 1710: 1646: 1592: 1545: 907: 759: 565: 336: 310: 235: 3968: 3906: 3598: 3298: 3206: 3163: 3148: 2258: 2060: 1616: 1452: 654: 489:
T-loops. Here, the single-stranded DNA curls around in a long circle, stabilized by
161:. In most, if not all species possessing them, they protect the terminal regions of 5952: 5428: 5413: 5325: 5266: 5165: 5135: 5044: 4549: 4423: 4387: 3465:"Telomerase RNA in Hymenoptera (Insecta) switched to plant/ciliate-like biogenesis" 3097: 2327: 1366: 1280: 748: 690: 406: 330: 239: 215: 17: 2427: 584: 456:. Telomerase can be reactivated and telomeres reset back to an embryonic state by 4135:"No sex differences in adult telomere length across vertebrates: a meta-analysis" 3132: 2341:
Williams TL, Levy DL, Maki-Yonekura S, Yonekura K, Blackburn EH (November 2010).
2044: 5947: 5858: 5720: 5418: 5408: 5403: 4768: 4763: 4626: 4604: 4599: 4467: 2644:
Mathur MB, Epel E, Kind S, Desai M, Parks CG, Sandler DP, Khazeni N (May 2016).
1335: 924: 843: 826: 790: 766: 724: 3794: 3630: 2769: 2750: 2717: 1886:
Proceedings of the National Academy of Sciences of the United States of America
1306: 5959: 5776: 5345: 5298: 5221: 5130: 4788: 4778: 4773: 4758: 4698: 4688: 4589: 4564: 4538: 4489: 4479: 4427: 3844: 2661: 2507: 1952: 1350: 1325: 1302: 903: 850: 808: 681: 650: 542: 461: 434: 414: 402: 390: 321: 253: 166: 150: 146: 46: 4282: 4233: 4166: 4103: 4036: 3639: 3537: 3488: 3337: 2278: 2109: 1804: 1600: 1553: 1498: 1483:"[Principle of marginotomy in template synthesis of polynucleotides]" 1436: 5878: 5569: 4740: 4484: 4462: 4443: 4392: 4012: 3688: 3081: 2809: 2359: 2159: 2142: 2100: 1991: 1906: 1412: 1356: 1288: 1276: 1256: 959: 772: 637:
of normal aging with respect to important cognitive and physical abilities.
477: 445: 441: 367: 306: 275: 158: 4347: 4329: 4290: 4241: 4184: 4111: 4054: 4028: 3960: 3898: 3890: 3863: 3812: 3755: 3706: 3657: 3506: 3480: 3437: 3396: 3355: 3290: 3255: 3198: 3046: 3011: 2968: 2933: 2876: 2827: 2778: 2735: 2679: 2627: 2578: 2560: 2525: 2476: 2419: 2378: 2241: 2224: 2209: 2168: 2127: 2052: 2009: 1960: 1866: 1767: 1749: 1576: 1482: 1444: 480:
in yeast to many kilobases in humans, and usually is composed of arrays of
41: 3996: 3983: 3590: 3555: 3329: 3140: 3089: 2858: 2319: 2250: 1925: 1718: 1608: 1561: 1506: 1295:, and even within smaller taxonomic groups these patterns appear diverse. 5888: 5652: 5548: 5448: 4510: 4134: 3737: 2458: 1882:"Conservation of the human telomere sequence (TTAGGG)n among vertebrates" 1654: 832: 730: 511: 347: 342: 325: 4158: 3582: 2915: 2594:"Telomere length, oxidative damage, antioxidants and breast cancer risk" 1428: 249:
for the discovery of how chromosomes are protected by telomeres and the
5898: 5388: 5281: 5059: 5054: 4896: 4750: 4661: 4656: 4069: 3939:
von Zglinicki T (March 2012). "Will your telomeres tell your future?".
2492:"The impact of oxidative DNA damage and stress on telomere homeostasis" 1292: 1251:
Tools have also been developed to estimate the length of telomere from
1150:
if you can. Unsourced or poorly sourced material may be challenged and
783: 622: 519: 481: 476:
Telomere length varies greatly between species, from approximately 300
410: 398: 394: 4273: 4256: 4224: 4207: 4085: 4017:
Philosophical Transactions of the Royal Society B: Biological Sciences
4013:"Heritability of telomere variation: it is all about the environment!" 3952: 3428: 3411: 3387: 3370: 3313: 2609: 1413:"2009 Nobel Prize in Physiology or Medicine: telomeres and telomerase" 646: 522:. There is a multitude of ways in which oxidative stress, mediated by 5997: 5433: 5025: 4806: 4693: 4457: 4453: 4448: 4255:
Chatelain, Marion; Drobniak, Szymon M.; Szulkin, Marta (2019-11-27).
2311: 918: 892: 707: 465: 250: 157:). Telomeres are a widespread genetic feature most commonly found in 149:
sequences associated with specialized proteins at the ends of linear
138: 121: 358: 5743: 5335: 4871: 4856: 4851: 4846: 4841: 4836: 4831: 4826: 4821: 4796: 4734: 2143:"Senescence and immortalization: role of telomeres and telomerase" 995: 977: 862: 686: 596:
The phenomenon of limited cellular division was first observed by
583: 424: 382: 378: 374: 40: 2277:, Nature, June 30, 2022; Nat Struct Mol Biol 29, 639–652 (2022). 5049: 4924: 386: 5521: 4928: 4396: 5039: 5035: 3164:"Measuring vertebrate telomeres: applications and limitations" 2751:"Telomerase as a Therapeutic Target in Cardiovascular Disease" 1115: 298: 162: 93: 81: 5475:
List of largest biomedical companies by market capitalization
4314:"Ectothermic telomeres: it's time they came in from the cold" 169:
systems from mistaking the very ends of the DNA strand for a
3722:"Estimating telomere length from whole genome sequence data" 514:
studies have shown that telomeres accumulate damage due to
99: 75: 69: 2441:
Burge S, Parkinson GN, Hazel P, Todd AK, Neidle S (2006).
1390:
During replication, multiple DNA-polymerases are involved.
2700:"Telomere dysfunction in ageing and age-related diseases" 1732:
Chow TT, Zhao Y, Mak SS, Shay JW, Wright WE (June 2012).
413:(that possess telomere repeats similar to those found in 362:
Shelterin co-ordinates the T-loop formation of telomeres.
1577:"Telomeres, telomerase, and aging: origin of the theory" 397:. In many species, the sequence repeats are enriched in 27:
Region of repetitive nucleotide sequences on chromosomes
4914:
International System for Human Cytogenetic Nomenclature
4375:
Telomerase and the Consequences of Telomere Dysfunction
4011:
Dugdale, Hannah L.; Richardson, David S. (2018-01-15).
1147: 4206:
Pepke, Michael Le; Eisenberg, Dan T. A. (2021-03-16).
2698:
Rossiello F, Jurk D, Passos JF, di Fagagna F (2022).
2076:"Telomere shortening rate predicts species life span" 1244:), software processing the TRF pictures. A Real-Time 2843:"Telomeres and the natural lifespan limit in humans" 2184:"Telomeres, telomerase, and tumorigenesis--a review" 557:, longer telomeres may be associated with lifespan. 96: 90: 72: 66: 30:
For the use of "telomere" in insect morphology, see
5968: 5921: 5789: 5757: 5734: 5711: 5702: 5693: 5668: 5628: 5585: 5576: 5457: 5364: 5244: 5174: 5123: 5114: 5073: 5018: 4997: 4962: 4884: 4787: 4749: 4719: 4647: 4503: 4434: 1976:"Telomerase Repeated Amplification Protocol (TRAP)" 87: 78: 63: 3162:Nakagawa S, Gemmell NJ, Burke T (September 2004). 2756:Arteriosclerosis, Thrombosis, and Vascular Biology 2749:Hoffmann J, Richardson G, Spyridopoulos I (2021). 2443:"Quadruplex DNA: sequence, topology and structure" 1782: 4095:20.500.11820/91f3fc9e-4a69-4ac4-a8a0-45c93ccbf3b5 2639: 2637: 2271:Barnes, R.P., de Rosa, M., Thosar, S.A., et al., 1880:Meyne J, Ratliff RL, Moyzis RK (September 1989). 2394:"Mammalian telomeres end in a large duplex loop" 2693: 2691: 2689: 2080:Proceedings of the National Academy of Sciences 649:. Some of the experimentally verified telomere 4365:Telomeres and Telomerase: The Means to the End 2890:Pepper GV, Bateson M, Nettle D (August 2018). 1146:Please review the contents of the section and 287:cannot replicate the sequences present at the 5533: 4940: 4408: 4312:Olsson M, Wapstra E, Friesen C (March 2018). 8: 536:Relationship between telomeres and longevity 317:degraded in the process of DNA replication. 676:Telomeric repeat (5' to 3' toward the end) 5708: 5699: 5582: 5540: 5526: 5518: 5120: 4947: 4933: 4925: 4746: 4415: 4401: 4393: 3673:"Telomere measurement by quantitative PCR" 2279:https://doi.org/10.1038/s41594-022-00790-y 429:Synthesis of chromosome ends by telomerase 4337: 4272: 4223: 4174: 4093: 4044: 3995: 3853: 3843: 3802: 3745: 3696: 3647: 3629: 3545: 3496: 3427: 3386: 3345: 3245: 2923: 2866: 2817: 2768: 2725: 2669: 2617: 2568: 2541:"Does oxidative stress shorten telomeres 2515: 2490:Barnes R, Fouquerel E, Opresko P (2019). 2466: 2409: 2368: 2358: 2240: 2199: 2158: 2117: 2099: 1999: 1915: 1905: 1856: 1757: 1229:senescence-associated secretory phenotype 665:Some known telomere nucleotide sequences 4980:Competitions and prizes in biotechnology 3922:"A Blood Test Offers Clues to Longevity" 2961:10.1146/annurev-publhealth-040119-094239 1789:(5th ed.). New York: W.H. Freeman. 1781:Nelson DL, Lehninger AL, Cox MM (2008). 1411:Varela, E.; Blasco, M. A. (March 2010). 663: 561:Potential effect of psychological stress 510:Apart from the end replication problem, 357: 274: 145: 'part') is a region of repetitive 1841:"Role of shelterin in cancer and aging" 1403: 1383: 3520:Allshire RC, et al. (June 1989). 2841:Steenstrup T, Kark JD, Aviv A (2017). 2225:"Telomeres, telomerase and senescence" 1839:Martínez P, Blasco MA (October 2010). 226:, working as a postdoctoral fellow at 4904:List of organisms by chromosome count 3457: 3455: 2539:Reichert S, Stier A (December 2017). 279:Lagging strand during DNA replication 247:Nobel Prize in Physiology or Medicine 7: 5500: 3283:10.1016/j.neurobiolaging.2010.11.013 2496:Mechanisms of Ageing and Development 1785:Lehninger Principles of Biochemistry 1628: 1626: 206:In the early 1970s, Soviet theorist 2347:The Journal of Biological Chemistry 1974:Mender I, Shay JW (November 2015). 5609:Short tandem repeat/Microsatellite 3984:"Spit test offers guide to health" 49:(grey) capped by telomeres (white) 25: 1007:TGTGGGTGTGGTG (from RNA template) 5499: 5488: 5487: 4988: 3920:Pollack, Andrew (May 18, 2011). 3238:10.1111/j.1474-9726.2011.00718.x 3191:10.1111/j.1365-294X.2004.02291.x 1858:10.1111/j.1474-9726.2010.00596.x 1820:"Bacterial Chromosome Structure" 1305: 1212: 1120: 1009:or G(2-3)(TG)(1-6)T (consensus) 600:, and is now referred to as the 405:, which allows the formation of 59: 5465:Index of biotechnology articles 4525:Macrochromosome/Microchromosome 2598:International Journal of Cancer 2141:Shay JW, Wright WE (May 2005). 1520:Olovnikov, A. M. (1973-09-14). 1470:. Woods Hole. pp. 181–198. 568:found that increased perceived 486:3′ single-stranded-DNA overhang 5613:Trinucleotide repeat disorders 5470:List of biotechnology articles 2949:Annual Review of Public Health 1691:Journal of Theoretical Biology 1671:. Nobel Foundation. 2009-10-05 1526:Journal of Theoretical Biology 1372:Immortal DNA strand hypothesis 1148:add the appropriate references 328:chromosomes (such as those in 154: 1: 5600:Variable number tandem repeat 5314:Genetically modified organism 5081:Biotechnology industrial park 2650:Brain, Behavior, and Immunity 2411:10.1016/S0092-8674(00)80760-6 661:for letter representations). 653:sequences are also listed in 458:somatic cell nuclear transfer 4384:DNA Ends: Just the Beginning 3133:10.1126/science.279.5349.349 3039:10.1016/0014-4827(65)90211-9 3004:10.1016/0014-4827(61)90192-6 2798:Molecular Human Reproduction 2045:10.1126/science.288.5466.665 1711:10.1016/0022-5193(73)90198-7 1647:10.1016/0022-2836(78)90294-2 1635:Journal of Molecular Biology 1593:10.1016/0531-5565(96)00005-8 1546:10.1016/0022-5193(73)90198-7 32:Telomere (insect morphology) 5304:Environmental biotechnology 1468:The Remaking of Chromosomes 1133:reliable medical references 354:Telomere ends and shelterin 6065: 4565:Dinoflagellate chromosomes 4139:Royal Society Open Science 3795:10.1038/s41598-017-14403-y 3631:10.1186/s12859-021-04064-0 3027:Experimental Cell Research 2992:Experimental Cell Research 2896:Royal Society Open Science 2770:10.1161/ATVBAHA.120.315695 2718:10.1038/s41556-022-00842-x 2223:Greider CW (August 1990). 1487:Doklady Akademii Nauk SSSR 1331:DNA damage theory of aging 1105:GGTGTACGGATTTGATTAGGTATGT 1093:GGTGTACGGATTTGATTAGTTATGT 621:Two studies on long-lived 533: 432: 365: 303:lagging strand replication 268: 131: 114: 29: 5567: 5483: 4986: 4975:Timeline of biotechnology 4909:List of sequenced genomes 4677:Chromosomal translocation 4550:A chromosome/B chromosome 4541:(or accessory chromosome) 3845:10.1186/s12859-019-2851-0 2662:10.1016/j.bbi.2016.02.002 2508:10.1016/j.mad.2018.03.013 1953:10.1016/j.tcb.2009.05.002 1818:Maloy S (July 12, 2002). 1575:Olovnikov, A. M. (1996). 1481:Olovnikov, A. M. (1971). 1139:or relies too heavily on 993: 984:Schizosaccharomyces pombe 917: 860: 782: 723: 491:telomere-binding proteins 464:and in the prevention of 185:, studying the fruit fly 36:Telomere (disambiguation) 6039:Repetitive DNA sequences 5331:Microbial biodegradation 5010:Industrial biotechnology 4970:History of biotechnology 4731:Telomere-binding protein 4545:Supernumerary chromosome 1581:Experimental Gerontology 1362:Telomere-binding protein 1112:Research on disease risk 1088:Candida pseudotropicalis 1069:GGTGTACGGATGCAGACTCGCTT 1045:GGTGTACGGATGTCTAACTTCTT 1002:Saccharomyces cerevisiae 283:During DNA replication, 128: 'end' and 5005:Colors of biotechnology 3671:Cawthon RM (May 2002). 3082:10.1126/science.7544491 2360:10.1074/jbc.M110.170167 2101:10.1073/pnas.1902452116 1992:10.21769/bioprotoc.1657 1907:10.1073/pnas.86.18.7049 1738:Genes & Development 1253:whole genome sequencing 1057:GGTGTAGGATGTCACGATCATT 1016:Saccharomyces castellii 524:reactive oxygen species 265:End replication problem 188:Drosophila melanogaster 6008:Protein tandem repeats 5936:Tandemly arrayed genes 5399:Biomedical engineering 5106:Pharmaceutical company 5086:Biotechnology products 4667:Structural alterations 4330:10.1098/rstb.2016.0449 4029:10.1098/rstb.2016.0450 3891:10.1038/nprot.2006.263 3726:Nucleic Acids Research 3677:Nucleic Acids Research 3538:10.1093/nar/17.12.4611 3526:Nucleic Acids Research 3469:Nucleic Acids Research 3318:Nucleic Acids Research 2561:10.1098/rsbl.2017.0463 2447:Nucleic Acids Research 2242:10.1002/bies.950120803 1941:Trends in Cell Biology 1750:10.1101/gad.187211.112 593: 530:Association with aging 430: 363: 280: 260:Structure and function 50: 34:. For other uses, see 4684:Numerical alterations 4672:Chromosomal inversion 4570:Homologous chromosome 3997:10.1038/news.2011.330 3689:10.1093/nar/30.10.e47 3271:Neurobiology of Aging 2859:10.18632/aging.101216 2810:10.1093/molehr/gas028 2160:10.1093/carcin/bgh296 1466:Muller, H.J. (1938). 1076:Candida guillermondii 659:nucleic acid notation 631:Oceanodroma leucorhoa 587: 428: 361: 278: 183:Hermann Joseph Muller 44: 5981:Pathogenicity island 5424:Chemical engineering 5287:Reproductive cloning 5151:Hybridoma technology 5101:Human Genome Project 4892:Extrachromosomal DNA 4580:Satellite chromosome 4555:Lampbrush chromosome 4495:Nuclear organization 3826:Feuerbach L (2019). 3571:Nature Biotechnology 3481:10.1093/nar/gkac1202 2182:Wai LK (July 2004). 1346:Rejuvenation (aging) 1100:Kluyveromyces lactis 966:Ascaris lumbricoides 869:Arabidopsis thaliana 627:Leach's storm-petrel 570:psychological stress 450:embryonic stem cells 5309:Genetic engineering 5292:Therapeutic cloning 5272:Bionic architecture 5252:Animal cell culture 5019:Biological concepts 4585:Centromere position 4560:Polytene chromosome 4530:Circular chromosome 4369:Elizabeth Blackburn 4159:10.1098/rsos.200548 4151:2020RSOS....700548R 3982:Marchant J (2011). 3787:2018NatSR...8.1300F 3583:10.1038/nbt0898-743 3330:10.1093/nar/gkad672 3183:2004MolEc..13.2523N 3125:1998Sci...279..349B 3074:1995Sci...269.1236F 2916:10.1098/rsos.180744 2908:2018RSOS....580744P 2705:Nature Cell Biology 2304:1984Natur.310..154S 2092:2019PNAS..11615122W 2086:(30): 15122–15127. 2037:2000Sci...288..665L 1898:1989PNAS...86.7049M 1703:1973JThBi..41..181O 1538:1973JThBi..41..181O 1429:10.1038/onc.2010.15 1264:Elizabeth Blackburn 666: 655:Telomerase Database 608:by Geron's founder 547:cellular senescence 224:Elizabeth Blackburn 214:'s idea of limited 171:double-strand break 18:Telomere shortening 5931:Gene amplification 5365:Interdisciplinary 5319:Molecular genetics 5065:Selective breeding 4324:(1741): 20160449. 4023:(1741): 20160450. 3926:The New York Times 3832:BMC Bioinformatics 3775:Scientific Reports 3769:Farmery J (2018). 3738:10.1093/nar/gku181 3618:BMC Bioinformatics 2459:10.1093/nar/gkl655 1353:, biological aging 1052:Candida tropicalis 664: 594: 431: 364: 281: 193:Barbara McClintock 51: 6034:Molecular biology 6016: 6015: 5917: 5916: 5785: 5784: 5689: 5688: 5578:Repeated sequence 5553:repeated sequence 5515: 5514: 5444:Nanobiotechnology 5439:Molecular biology 5240: 5239: 5091:Biotechnology law 4922: 4921: 4880: 4879: 4617:Centromere number 4534:Linear chromosome 4386:Nobel Lecture by 4377:Nobel Lecture by 4367:Nobel Lecture by 4274:10.1111/ele.13426 4225:10.1111/mec.15870 4218:(23): 6286–6296. 4212:Molecular Ecology 4086:10.1111/mec.16145 4080:(23): 5917–5932. 4074:Molecular Ecology 3953:10.1136/bmj.e1727 3429:10.1111/tpj.13115 3416:The Plant Journal 3388:10.1111/tpj.12839 3375:The Plant Journal 3324:(D1): D311–D321. 3171:Molecular Ecology 3068:(5228): 1236–41. 2610:10.1002/ijc.24105 1744:(11): 1167–1178. 1423:(11): 1561–1565. 1341:Maximum life span 1221: 1220: 1197: 1109: 1108: 989:TTAC(A)(C)G(1-8) 937:Bombus terrestris 714:Neurospora crassa 606:Geron Corporation 495:displacement loop 454:white blood cells 401:, e.g. TTAGGG in 242:were awarded the 191:, and in 1939 by 16:(Redirected from 6056: 5993:Low copy repeats 5986:Symbiosis island 5923:Gene duplication 5709: 5700: 5583: 5561:gene duplication 5542: 5535: 5528: 5519: 5503: 5502: 5491: 5490: 5341:Pharmacogenomics 5121: 5115:Basic techniques 5096:Green Revolution 5074:General concepts 4992: 4949: 4942: 4935: 4926: 4747: 4711:Polyploidization 4539:Extra chromosome 4454:Genetic material 4417: 4410: 4403: 4394: 4352: 4351: 4341: 4309: 4303: 4302: 4276: 4252: 4246: 4245: 4227: 4203: 4197: 4196: 4178: 4130: 4124: 4123: 4097: 4065: 4059: 4058: 4048: 4008: 4002: 4001: 3999: 3979: 3973: 3972: 3936: 3930: 3929: 3917: 3911: 3910: 3879:Nature Protocols 3874: 3868: 3867: 3857: 3847: 3823: 3817: 3816: 3806: 3766: 3760: 3759: 3749: 3717: 3711: 3710: 3700: 3668: 3662: 3661: 3651: 3633: 3609: 3603: 3602: 3566: 3560: 3559: 3549: 3517: 3511: 3510: 3500: 3459: 3450: 3449: 3431: 3407: 3401: 3400: 3390: 3366: 3360: 3359: 3349: 3309: 3303: 3302: 3277:(7): 1486.e3–8. 3266: 3260: 3259: 3249: 3217: 3211: 3210: 3168: 3159: 3153: 3152: 3119:(5349): 349–52. 3108: 3102: 3101: 3057: 3051: 3050: 3022: 3016: 3015: 2987: 2981: 2980: 2944: 2938: 2937: 2927: 2887: 2881: 2880: 2870: 2838: 2832: 2831: 2821: 2789: 2783: 2782: 2772: 2763:(3): 1047–1061. 2746: 2740: 2739: 2729: 2695: 2684: 2683: 2673: 2641: 2632: 2631: 2621: 2589: 2583: 2582: 2572: 2555:(12): 20170463. 2536: 2530: 2529: 2519: 2487: 2481: 2480: 2470: 2438: 2432: 2431: 2413: 2389: 2383: 2382: 2372: 2362: 2353:(46): 35814–24. 2338: 2332: 2331: 2312:10.1038/310154a0 2287: 2281: 2269: 2263: 2262: 2244: 2220: 2214: 2213: 2203: 2179: 2173: 2172: 2162: 2138: 2132: 2131: 2121: 2103: 2071: 2065: 2064: 2020: 2014: 2013: 2003: 1971: 1965: 1964: 1936: 1930: 1929: 1919: 1909: 1877: 1871: 1870: 1860: 1836: 1830: 1829: 1827: 1826: 1815: 1809: 1808: 1788: 1778: 1772: 1771: 1761: 1729: 1723: 1722: 1686: 1680: 1679: 1677: 1676: 1665: 1659: 1658: 1630: 1621: 1620: 1572: 1566: 1565: 1517: 1511: 1510: 1493:(6): 1496–1499. 1478: 1472: 1471: 1463: 1457: 1456: 1408: 1391: 1388: 1321:Epigenetic clock 1315: 1310: 1309: 1216: 1215: 1207: 1204: 1198: 1196: 1155: 1124: 1123: 1116: 1040:Candida albicans 1033:GGGGTCTGGGTGCTG 1028:Candida glabrata 949:Vespula vulgaris 667: 598:Leonard Hayflick 574:publication bias 516:oxidative stress 506:Oxidative damage 444:, some types of 212:Leonard Hayflick 208:Alexey Olovnikov 142: 135: 125: 118: 106: 105: 102: 101: 98: 95: 92: 89: 84: 83: 80: 77: 74: 71: 68: 65: 21: 6064: 6063: 6059: 6058: 6057: 6055: 6054: 6053: 6019: 6018: 6017: 6012: 5964: 5913: 5781: 5753: 5730: 5704:Retrotransposon 5685: 5676:Inverted repeat 5664: 5649:DNA transposon 5645:Retrotransposon 5640:Gene conversion 5631: 5624: 5621: 5572: 5563: 5546: 5516: 5511: 5479: 5453: 5394:Biopharmacology 5366: 5360: 5236: 5207:Electrophoresis 5202:Kidney dialysis 5192:Crystallization 5170: 5116: 5110: 5069: 5014: 4993: 4984: 4958: 4953: 4923: 4918: 4876: 4783: 4745: 4715: 4704:Paleopolyploidy 4649: 4643: 4499: 4473:Heterochromatin 4436: 4430: 4421: 4361: 4356: 4355: 4311: 4310: 4306: 4261:Ecology Letters 4254: 4253: 4249: 4205: 4204: 4200: 4132: 4131: 4127: 4067: 4066: 4062: 4010: 4009: 4005: 3981: 3980: 3976: 3938: 3937: 3933: 3919: 3918: 3914: 3876: 3875: 3871: 3825: 3824: 3820: 3768: 3767: 3763: 3720:Ding Z (2014). 3719: 3718: 3714: 3670: 3669: 3665: 3611: 3610: 3606: 3568: 3567: 3563: 3532:(12): 4611–27. 3519: 3518: 3514: 3461: 3460: 3453: 3409: 3408: 3404: 3368: 3367: 3363: 3311: 3310: 3306: 3268: 3267: 3263: 3219: 3218: 3214: 3166: 3161: 3160: 3156: 3110: 3109: 3105: 3059: 3058: 3054: 3024: 3023: 3019: 2989: 2988: 2984: 2946: 2945: 2941: 2889: 2888: 2884: 2853:(4): 130–1142. 2840: 2839: 2835: 2791: 2790: 2786: 2748: 2747: 2743: 2697: 2696: 2687: 2643: 2642: 2635: 2591: 2590: 2586: 2549:Biology Letters 2538: 2537: 2533: 2489: 2488: 2484: 2453:(19): 5402–15. 2440: 2439: 2435: 2391: 2390: 2386: 2340: 2339: 2335: 2298:(5973): 154–7. 2289: 2288: 2284: 2270: 2266: 2222: 2221: 2217: 2181: 2180: 2176: 2140: 2139: 2135: 2073: 2072: 2068: 2031:(5466): 665–9. 2022: 2021: 2017: 1973: 1972: 1968: 1938: 1937: 1933: 1892:(18): 7049–53. 1879: 1878: 1874: 1838: 1837: 1833: 1824: 1822: 1817: 1816: 1812: 1797: 1780: 1779: 1775: 1731: 1730: 1726: 1688: 1687: 1683: 1674: 1672: 1667: 1666: 1662: 1632: 1631: 1624: 1574: 1573: 1569: 1519: 1518: 1514: 1480: 1479: 1475: 1465: 1464: 1460: 1410: 1409: 1405: 1400: 1395: 1394: 1389: 1385: 1380: 1311: 1304: 1301: 1272: 1237: 1225:senescent cells 1217: 1213: 1208: 1202: 1199: 1156: 1145: 1141:primary sources 1125: 1121: 1114: 1064:Candida maltosa 1008: 881:Cestrum elegans 643: 610:Michael D. West 582: 563: 555:life expectancy 538: 532: 508: 503: 474: 437: 423: 370: 356: 273: 271:DNA replication 267: 262: 228:Yale University 179: 163:chromosomal DNA 86: 62: 58: 39: 28: 23: 22: 15: 12: 11: 5: 6062: 6060: 6052: 6051: 6049:Non-coding DNA 6046: 6041: 6036: 6031: 6021: 6020: 6014: 6013: 6011: 6010: 6005: 6000: 5995: 5990: 5989: 5988: 5983: 5976:Genomic island 5972: 5970: 5966: 5965: 5963: 5962: 5957: 5956: 5955: 5945: 5944: 5943: 5933: 5927: 5925: 5919: 5918: 5915: 5914: 5912: 5911: 5906: 5901: 5896: 5891: 5886: 5881: 5876: 5871: 5866: 5861: 5856: 5851: 5846: 5841: 5836: 5831: 5826: 5821: 5816: 5811: 5806: 5801: 5795: 5793: 5791:DNA transposon 5787: 5786: 5783: 5782: 5780: 5779: 5774: 5769: 5763: 5761: 5755: 5754: 5752: 5751: 5746: 5740: 5738: 5732: 5731: 5729: 5728: 5723: 5717: 5715: 5706: 5697: 5691: 5690: 5687: 5686: 5684: 5683: 5678: 5672: 5670: 5666: 5665: 5663: 5662: 5661: 5660: 5655: 5647: 5642: 5636: 5634: 5626: 5625: 5623: 5622: 5619:Macrosatellite 5616: 5606: 5597: 5591: 5589: 5587:Tandem repeats 5580: 5574: 5573: 5568: 5565: 5564: 5547: 5545: 5544: 5537: 5530: 5522: 5513: 5512: 5510: 5509: 5497: 5484: 5481: 5480: 5478: 5477: 5472: 5467: 5461: 5459: 5455: 5454: 5452: 5451: 5446: 5441: 5436: 5431: 5426: 5421: 5416: 5411: 5406: 5401: 5396: 5391: 5386: 5384:Bioengineering 5381: 5379:Bioelectronics 5376: 5370: 5368: 5362: 5361: 5359: 5358: 5356:Tissue culture 5353: 5348: 5343: 5338: 5333: 5328: 5323: 5322: 5321: 5316: 5306: 5301: 5296: 5295: 5294: 5289: 5279: 5274: 5269: 5264: 5262:Bioinformatics 5259: 5257:Biofabrication 5254: 5248: 5246: 5242: 5241: 5238: 5237: 5235: 5234: 5229: 5224: 5219: 5214: 5209: 5204: 5199: 5197:Chromatography 5194: 5189: 5184: 5182:Centrifugation 5178: 5176: 5175:Chemical field 5172: 5171: 5169: 5168: 5163: 5158: 5153: 5148: 5146:Flow cytometry 5143: 5138: 5133: 5127: 5125: 5118: 5112: 5111: 5109: 5108: 5103: 5098: 5093: 5088: 5083: 5077: 5075: 5071: 5070: 5068: 5067: 5062: 5057: 5052: 5047: 5042: 5033: 5028: 5022: 5020: 5016: 5015: 5013: 5012: 5007: 5001: 4999: 4995: 4994: 4987: 4985: 4983: 4982: 4977: 4972: 4966: 4964: 4960: 4959: 4954: 4952: 4951: 4944: 4937: 4929: 4920: 4919: 4917: 4916: 4911: 4906: 4901: 4900: 4899: 4888: 4886: 4882: 4881: 4878: 4877: 4875: 4874: 4869: 4864: 4859: 4854: 4849: 4844: 4839: 4834: 4829: 4824: 4819: 4814: 4809: 4804: 4799: 4793: 4791: 4785: 4784: 4782: 4781: 4776: 4771: 4766: 4761: 4755: 4753: 4744: 4743: 4738: 4723: 4721: 4717: 4716: 4714: 4713: 4708: 4707: 4706: 4701: 4696: 4691: 4681: 4680: 4679: 4674: 4664: 4659: 4653: 4651: 4645: 4644: 4642: 4641: 4640: 4639: 4634: 4629: 4624: 4614: 4613: 4612: 4607: 4602: 4597: 4595:Submetacentric 4592: 4582: 4577: 4572: 4567: 4562: 4557: 4552: 4547: 4542: 4536: 4527: 4522: 4521:or heterosome) 4515:Sex chromosome 4507: 4505: 4501: 4500: 4498: 4497: 4492: 4487: 4482: 4477: 4476: 4475: 4470: 4460: 4451: 4446: 4440: 4438: 4432: 4431: 4422: 4420: 4419: 4412: 4405: 4397: 4391: 4390: 4381: 4372: 4360: 4359:External links 4357: 4354: 4353: 4304: 4267:(2): 381–398. 4247: 4198: 4145:(11): 200548. 4125: 4060: 4003: 3974: 3931: 3912: 3885:(5): 2365–76. 3869: 3818: 3761: 3712: 3683:(10): 47e–47. 3663: 3604: 3561: 3512: 3475:(1): 420–433. 3451: 3402: 3361: 3304: 3261: 3212: 3177:(9): 2523–33. 3154: 3103: 3052: 3017: 2998:(3): 585–621. 2982: 2939: 2882: 2833: 2804:(11): 517–22. 2784: 2741: 2712:(2): 135–147. 2685: 2633: 2604:(7): 1637–43. 2584: 2531: 2482: 2433: 2384: 2333: 2282: 2264: 2215: 2174: 2147:Carcinogenesis 2133: 2066: 2015: 1966: 1931: 1872: 1831: 1810: 1795: 1773: 1724: 1681: 1660: 1622: 1587:(4): 443–448. 1567: 1532:(1): 181–190. 1512: 1473: 1458: 1402: 1401: 1399: 1396: 1393: 1392: 1382: 1381: 1379: 1376: 1375: 1374: 1369: 1364: 1359: 1354: 1348: 1343: 1338: 1333: 1328: 1323: 1317: 1316: 1313:Biology portal 1300: 1297: 1271: 1268: 1236: 1233: 1219: 1218: 1211: 1209: 1128: 1126: 1119: 1113: 1110: 1107: 1106: 1103: 1095: 1094: 1091: 1083: 1082: 1079: 1071: 1070: 1067: 1059: 1058: 1055: 1047: 1046: 1043: 1035: 1034: 1031: 1023: 1022: 1019: 1011: 1010: 1005: 998: 991: 990: 987: 980: 973: 972: 969: 962: 956: 955: 952: 944: 943: 940: 932: 931: 928: 921: 915: 914: 911: 900: 899: 896: 888: 887: 884: 876: 875: 872: 865: 858: 857: 854: 847: 840: 839: 836: 816: 815: 812: 804: 803: 800: 787: 780: 779: 776: 763: 756: 755: 752: 744: 743: 740: 727: 721: 720: 717: 710: 703: 702: 699: 684: 678: 677: 674: 671: 642: 639: 602:Hayflick limit 590:Hayflick limit 581: 578: 562: 559: 534:Main article: 531: 528: 507: 504: 502: 499: 473: 470: 452:, and certain 433:Main article: 422: 419: 407:G-quadruplexes 366:Main article: 355: 352: 285:DNA polymerase 269:Main article: 266: 263: 261: 258: 232:Joseph G. Gall 222:In 1975–1977, 178: 175: 26: 24: 14: 13: 10: 9: 6: 4: 3: 2: 6061: 6050: 6047: 6045: 6042: 6040: 6037: 6035: 6032: 6030: 6027: 6026: 6024: 6009: 6006: 6004: 6001: 5999: 5996: 5994: 5991: 5987: 5984: 5982: 5979: 5978: 5977: 5974: 5973: 5971: 5967: 5961: 5958: 5954: 5951: 5950: 5949: 5946: 5942: 5941:Ribosomal DNA 5939: 5938: 5937: 5934: 5932: 5929: 5928: 5926: 5924: 5920: 5910: 5907: 5905: 5902: 5900: 5897: 5895: 5892: 5890: 5887: 5885: 5882: 5880: 5877: 5875: 5872: 5870: 5867: 5865: 5862: 5860: 5857: 5855: 5852: 5850: 5847: 5845: 5842: 5840: 5837: 5835: 5832: 5830: 5827: 5825: 5822: 5820: 5817: 5815: 5812: 5810: 5807: 5805: 5802: 5800: 5797: 5796: 5794: 5792: 5788: 5778: 5775: 5773: 5770: 5768: 5765: 5764: 5762: 5760: 5756: 5750: 5747: 5745: 5742: 5741: 5739: 5737: 5733: 5727: 5724: 5722: 5719: 5718: 5716: 5714: 5710: 5707: 5705: 5701: 5698: 5696: 5692: 5682: 5681:Direct repeat 5679: 5677: 5674: 5673: 5671: 5667: 5659: 5656: 5654: 5651: 5650: 5648: 5646: 5643: 5641: 5638: 5637: 5635: 5633: 5627: 5620: 5617: 5614: 5610: 5607: 5605: 5604:Minisatellite 5601: 5598: 5596: 5595:Satellite DNA 5593: 5592: 5590: 5588: 5584: 5581: 5579: 5575: 5571: 5566: 5562: 5558: 5554: 5550: 5543: 5538: 5536: 5531: 5529: 5524: 5523: 5520: 5508: 5507: 5498: 5496: 5495: 5486: 5485: 5482: 5476: 5473: 5471: 5468: 5466: 5463: 5462: 5460: 5456: 5450: 5447: 5445: 5442: 5440: 5437: 5435: 5432: 5430: 5427: 5425: 5422: 5420: 5417: 5415: 5412: 5410: 5407: 5405: 5402: 5400: 5397: 5395: 5392: 5390: 5387: 5385: 5382: 5380: 5377: 5375: 5372: 5371: 5369: 5363: 5357: 5354: 5352: 5349: 5347: 5344: 5342: 5339: 5337: 5334: 5332: 5329: 5327: 5324: 5320: 5317: 5315: 5312: 5311: 5310: 5307: 5305: 5302: 5300: 5297: 5293: 5290: 5288: 5285: 5284: 5283: 5280: 5278: 5277:Cell immunity 5275: 5273: 5270: 5268: 5265: 5263: 5260: 5258: 5255: 5253: 5250: 5249: 5247: 5243: 5233: 5232:Sedimentation 5230: 5228: 5225: 5223: 5220: 5218: 5215: 5213: 5210: 5208: 5205: 5203: 5200: 5198: 5195: 5193: 5190: 5188: 5185: 5183: 5180: 5179: 5177: 5173: 5167: 5164: 5162: 5159: 5157: 5154: 5152: 5149: 5147: 5144: 5142: 5141:Cultured meat 5139: 5137: 5134: 5132: 5129: 5128: 5126: 5124:Biology field 5122: 5119: 5113: 5107: 5104: 5102: 5099: 5097: 5094: 5092: 5089: 5087: 5084: 5082: 5079: 5078: 5076: 5072: 5066: 5063: 5061: 5058: 5056: 5053: 5051: 5048: 5046: 5043: 5041: 5037: 5034: 5032: 5029: 5027: 5024: 5023: 5021: 5017: 5011: 5008: 5006: 5003: 5002: 5000: 4996: 4991: 4981: 4978: 4976: 4973: 4971: 4968: 4967: 4965: 4961: 4957: 4956:Biotechnology 4950: 4945: 4943: 4938: 4936: 4931: 4930: 4927: 4915: 4912: 4910: 4907: 4905: 4902: 4898: 4895: 4894: 4893: 4890: 4889: 4887: 4883: 4873: 4870: 4868: 4865: 4863: 4860: 4858: 4855: 4853: 4850: 4848: 4845: 4843: 4840: 4838: 4835: 4833: 4830: 4828: 4825: 4823: 4820: 4818: 4815: 4813: 4810: 4808: 4805: 4803: 4800: 4798: 4795: 4794: 4792: 4790: 4786: 4780: 4777: 4775: 4772: 4770: 4767: 4765: 4762: 4760: 4757: 4756: 4754: 4752: 4748: 4742: 4739: 4736: 4732: 4728: 4725: 4724: 4722: 4718: 4712: 4709: 4705: 4702: 4700: 4697: 4695: 4692: 4690: 4687: 4686: 4685: 4682: 4678: 4675: 4673: 4670: 4669: 4668: 4665: 4663: 4660: 4658: 4655: 4654: 4652: 4650:and evolution 4646: 4638: 4635: 4633: 4630: 4628: 4625: 4623: 4620: 4619: 4618: 4615: 4611: 4608: 4606: 4603: 4601: 4598: 4596: 4593: 4591: 4588: 4587: 4586: 4583: 4581: 4578: 4576: 4575:Isochromosome 4573: 4571: 4568: 4566: 4563: 4561: 4558: 4556: 4553: 4551: 4548: 4546: 4543: 4540: 4537: 4535: 4531: 4528: 4526: 4523: 4520: 4516: 4512: 4509: 4508: 4506: 4502: 4496: 4493: 4491: 4488: 4486: 4483: 4481: 4478: 4474: 4471: 4469: 4466: 4465: 4464: 4461: 4459: 4455: 4452: 4450: 4447: 4445: 4442: 4441: 4439: 4433: 4429: 4425: 4418: 4413: 4411: 4406: 4404: 4399: 4398: 4395: 4389: 4385: 4382: 4380: 4379:Carol Greider 4376: 4373: 4370: 4366: 4363: 4362: 4358: 4349: 4345: 4340: 4335: 4331: 4327: 4323: 4319: 4315: 4308: 4305: 4300: 4296: 4292: 4288: 4284: 4280: 4275: 4270: 4266: 4262: 4258: 4251: 4248: 4243: 4239: 4235: 4231: 4226: 4221: 4217: 4213: 4209: 4202: 4199: 4194: 4190: 4186: 4182: 4177: 4172: 4168: 4164: 4160: 4156: 4152: 4148: 4144: 4140: 4136: 4129: 4126: 4121: 4117: 4113: 4109: 4105: 4101: 4096: 4091: 4087: 4083: 4079: 4075: 4071: 4064: 4061: 4056: 4052: 4047: 4042: 4038: 4034: 4030: 4026: 4022: 4018: 4014: 4007: 4004: 3998: 3993: 3989: 3985: 3978: 3975: 3970: 3966: 3962: 3958: 3954: 3950: 3946: 3942: 3935: 3932: 3927: 3923: 3916: 3913: 3908: 3904: 3900: 3896: 3892: 3888: 3884: 3880: 3873: 3870: 3865: 3861: 3856: 3851: 3846: 3841: 3837: 3833: 3829: 3822: 3819: 3814: 3810: 3805: 3800: 3796: 3792: 3788: 3784: 3780: 3776: 3772: 3765: 3762: 3757: 3753: 3748: 3743: 3739: 3735: 3731: 3727: 3723: 3716: 3713: 3708: 3704: 3699: 3694: 3690: 3686: 3682: 3678: 3674: 3667: 3664: 3659: 3655: 3650: 3645: 3641: 3637: 3632: 3627: 3623: 3619: 3615: 3608: 3605: 3600: 3596: 3592: 3588: 3584: 3580: 3576: 3572: 3565: 3562: 3557: 3553: 3548: 3543: 3539: 3535: 3531: 3527: 3523: 3516: 3513: 3508: 3504: 3499: 3494: 3490: 3486: 3482: 3478: 3474: 3470: 3466: 3458: 3456: 3452: 3447: 3443: 3439: 3435: 3430: 3425: 3422:(3): 337–47. 3421: 3417: 3413: 3406: 3403: 3398: 3394: 3389: 3384: 3381:(4): 644–54. 3380: 3376: 3372: 3365: 3362: 3357: 3353: 3348: 3343: 3339: 3335: 3331: 3327: 3323: 3319: 3315: 3308: 3305: 3300: 3296: 3292: 3288: 3284: 3280: 3276: 3272: 3265: 3262: 3257: 3253: 3248: 3243: 3239: 3235: 3231: 3227: 3223: 3216: 3213: 3208: 3204: 3200: 3196: 3192: 3188: 3184: 3180: 3176: 3172: 3165: 3158: 3155: 3150: 3146: 3142: 3138: 3134: 3130: 3126: 3122: 3118: 3114: 3107: 3104: 3099: 3095: 3091: 3087: 3083: 3079: 3075: 3071: 3067: 3063: 3056: 3053: 3048: 3044: 3040: 3036: 3033:(3): 614–36. 3032: 3028: 3021: 3018: 3013: 3009: 3005: 3001: 2997: 2993: 2986: 2983: 2978: 2974: 2970: 2966: 2962: 2958: 2954: 2950: 2943: 2940: 2935: 2931: 2926: 2921: 2917: 2913: 2909: 2905: 2902:(8): 180744. 2901: 2897: 2893: 2886: 2883: 2878: 2874: 2869: 2864: 2860: 2856: 2852: 2848: 2844: 2837: 2834: 2829: 2825: 2820: 2815: 2811: 2807: 2803: 2799: 2795: 2788: 2785: 2780: 2776: 2771: 2766: 2762: 2758: 2757: 2752: 2745: 2742: 2737: 2733: 2728: 2723: 2719: 2715: 2711: 2707: 2706: 2701: 2694: 2692: 2690: 2686: 2681: 2677: 2672: 2667: 2663: 2659: 2655: 2651: 2647: 2640: 2638: 2634: 2629: 2625: 2620: 2615: 2611: 2607: 2603: 2599: 2595: 2588: 2585: 2580: 2576: 2571: 2566: 2562: 2558: 2554: 2550: 2546: 2544: 2535: 2532: 2527: 2523: 2518: 2513: 2509: 2505: 2501: 2497: 2493: 2486: 2483: 2478: 2474: 2469: 2464: 2460: 2456: 2452: 2448: 2444: 2437: 2434: 2429: 2425: 2421: 2417: 2412: 2407: 2404:(4): 503–14. 2403: 2399: 2395: 2388: 2385: 2380: 2376: 2371: 2366: 2361: 2356: 2352: 2348: 2344: 2337: 2334: 2329: 2325: 2321: 2317: 2313: 2309: 2305: 2301: 2297: 2293: 2286: 2283: 2280: 2276: 2275: 2268: 2265: 2260: 2256: 2252: 2248: 2243: 2238: 2234: 2230: 2226: 2219: 2216: 2211: 2207: 2202: 2197: 2193: 2189: 2185: 2178: 2175: 2170: 2166: 2161: 2156: 2153:(5): 867–74. 2152: 2148: 2144: 2137: 2134: 2129: 2125: 2120: 2115: 2111: 2107: 2102: 2097: 2093: 2089: 2085: 2081: 2077: 2070: 2067: 2062: 2058: 2054: 2050: 2046: 2042: 2038: 2034: 2030: 2026: 2019: 2016: 2011: 2007: 2002: 1997: 1993: 1989: 1986:(22): e1657. 1985: 1981: 1977: 1970: 1967: 1962: 1958: 1954: 1950: 1947:(8): 414–22. 1946: 1942: 1935: 1932: 1927: 1923: 1918: 1913: 1908: 1903: 1899: 1895: 1891: 1887: 1883: 1876: 1873: 1868: 1864: 1859: 1854: 1851:(5): 653–66. 1850: 1846: 1842: 1835: 1832: 1821: 1814: 1811: 1806: 1802: 1798: 1796:9780716771081 1792: 1787: 1786: 1777: 1774: 1769: 1765: 1760: 1755: 1751: 1747: 1743: 1739: 1735: 1728: 1725: 1720: 1716: 1712: 1708: 1704: 1700: 1697:(1): 181–90. 1696: 1692: 1685: 1682: 1670: 1664: 1661: 1656: 1652: 1648: 1644: 1640: 1636: 1629: 1627: 1623: 1618: 1614: 1610: 1606: 1602: 1598: 1594: 1590: 1586: 1582: 1578: 1571: 1568: 1563: 1559: 1555: 1551: 1547: 1543: 1539: 1535: 1531: 1527: 1523: 1516: 1513: 1508: 1504: 1500: 1496: 1492: 1488: 1484: 1477: 1474: 1469: 1462: 1459: 1454: 1450: 1446: 1442: 1438: 1434: 1430: 1426: 1422: 1418: 1414: 1407: 1404: 1397: 1387: 1384: 1377: 1373: 1370: 1368: 1365: 1363: 1360: 1358: 1355: 1352: 1349: 1347: 1344: 1342: 1339: 1337: 1334: 1332: 1329: 1327: 1324: 1322: 1319: 1318: 1314: 1308: 1303: 1298: 1296: 1294: 1290: 1285: 1282: 1278: 1269: 1267: 1265: 1260: 1258: 1254: 1249: 1247: 1243: 1234: 1232: 1230: 1226: 1210: 1206: 1195: 1192: 1188: 1185: 1181: 1178: 1174: 1171: 1167: 1164: –  1163: 1159: 1158:Find sources: 1153: 1149: 1143: 1142: 1138: 1134: 1129:This section 1127: 1118: 1117: 1111: 1104: 1102: 1101: 1097: 1096: 1092: 1090: 1089: 1085: 1084: 1080: 1078: 1077: 1073: 1072: 1068: 1066: 1065: 1061: 1060: 1056: 1054: 1053: 1049: 1048: 1044: 1042: 1041: 1037: 1036: 1032: 1030: 1029: 1025: 1024: 1020: 1018: 1017: 1013: 1012: 1006: 1004: 1003: 999: 997: 992: 988: 986: 985: 981: 979: 975: 974: 970: 968: 967: 963: 961: 958: 957: 953: 951: 950: 946: 945: 941: 939: 938: 934: 933: 929: 927: 926: 922: 920: 916: 912: 910: 909: 908:Chlamydomonas 905: 902: 901: 898:CTCGGTTATGGG 897: 895: 894: 890: 889: 885: 883: 882: 878: 877: 873: 871: 870: 866: 864: 859: 855: 853: 852: 848: 845: 842: 841: 837: 835: 834: 829: 828: 823: 822: 818: 817: 813: 811: 810: 806: 805: 801: 799: 798: 793: 792: 788: 785: 781: 777: 775: 774: 769: 768: 764: 761: 760:Kinetoplastid 758: 757: 753: 751: 750: 749:Dictyostelium 746: 745: 741: 739: 738: 733: 732: 728: 726: 722: 718: 716: 715: 711: 709: 705: 704: 700: 698: 697: 692: 688: 685: 683: 680: 679: 675: 672: 669: 668: 662: 660: 657:website (see 656: 652: 648: 640: 638: 634: 632: 628: 624: 619: 617: 616: 611: 607: 603: 599: 591: 586: 579: 577: 575: 571: 567: 566:Meta-analyses 560: 558: 556: 550: 548: 545:response and 544: 537: 529: 527: 525: 521: 517: 513: 505: 500: 498: 496: 492: 487: 483: 479: 471: 469: 467: 463: 459: 455: 451: 447: 443: 436: 427: 420: 418: 416: 412: 408: 404: 400: 396: 392: 388: 384: 380: 376: 369: 360: 353: 351: 349: 345: 344: 339: 338: 337:Agrobacterium 333: 332: 327: 323: 318: 314: 312: 311:cell division 308: 304: 300: 295: 290: 286: 277: 272: 264: 259: 257: 255: 252: 248: 245: 241: 237: 236:Carol Greider 233: 229: 225: 220: 217: 213: 209: 204: 202: 198: 194: 190: 189: 184: 176: 174: 172: 168: 164: 160: 156: 152: 148: 144: 141: 134: 130: 127: 124: 117: 113: 110: 109:Ancient Greek 104: 56: 48: 43: 37: 33: 19: 6002: 5953:Gene cluster 5721:Alu sequence 5630:Interspersed 5504: 5492: 5429:Microbiology 5414:Biochemicals 5350: 5326:Gene therapy 5267:Biosynthesis 5245:Applications 5166:Spectroscopy 5136:Cell culture 5045:Fermentation 4726: 4616: 4584: 4424:Cytogenetics 4388:Jack Szostak 4321: 4317: 4307: 4264: 4260: 4250: 4215: 4211: 4201: 4142: 4138: 4128: 4077: 4073: 4063: 4020: 4016: 4006: 3987: 3977: 3944: 3940: 3934: 3925: 3915: 3882: 3878: 3872: 3835: 3831: 3821: 3778: 3774: 3764: 3729: 3725: 3715: 3680: 3676: 3666: 3621: 3617: 3607: 3577:(8): 743–7. 3574: 3570: 3564: 3529: 3525: 3515: 3472: 3468: 3419: 3415: 3405: 3378: 3374: 3364: 3321: 3317: 3307: 3274: 3270: 3264: 3232:(5): 761–8. 3229: 3225: 3215: 3174: 3170: 3157: 3116: 3112: 3106: 3065: 3061: 3055: 3030: 3026: 3020: 2995: 2991: 2985: 2952: 2948: 2942: 2899: 2895: 2885: 2850: 2846: 2836: 2801: 2797: 2787: 2760: 2754: 2744: 2709: 2703: 2653: 2649: 2601: 2597: 2587: 2552: 2548: 2542: 2534: 2499: 2495: 2485: 2450: 2446: 2436: 2401: 2397: 2387: 2350: 2346: 2336: 2295: 2291: 2285: 2272: 2267: 2235:(8): 363–9. 2232: 2228: 2218: 2191: 2187: 2177: 2150: 2146: 2136: 2083: 2079: 2069: 2028: 2024: 2018: 1983: 1980:Bio-Protocol 1979: 1969: 1944: 1940: 1934: 1889: 1885: 1875: 1848: 1844: 1834: 1823:. Retrieved 1813: 1784: 1776: 1741: 1737: 1727: 1694: 1690: 1684: 1673:. Retrieved 1663: 1641:(1): 33–53. 1638: 1634: 1584: 1580: 1570: 1529: 1525: 1515: 1490: 1486: 1476: 1467: 1461: 1420: 1416: 1406: 1386: 1286: 1281:heritability 1273: 1261: 1250: 1238: 1222: 1200: 1190: 1183: 1176: 1169: 1157: 1137:verification 1130: 1098: 1086: 1074: 1062: 1050: 1038: 1026: 1014: 1000: 982: 964: 954:TTGCGTCTGGG 947: 942:TTAGGTTGGGG 935: 923: 906: 891: 879: 867: 856:TTAGGG(T/C) 849: 844:Apicomplexan 831: 825: 819: 807: 795: 789: 771: 765: 747: 735: 729: 725:Slime moulds 712: 706:Filamentous 694: 644: 635: 630: 620: 613: 595: 564: 551: 539: 509: 475: 438: 371: 341: 335: 331:Streptomyces 329: 319: 315: 282: 240:Jack Szostak 221: 216:somatic cell 205: 200: 196: 186: 180: 139: 136: 129: 122: 119: 112: 107:; from 54: 52: 6029:Chromosomes 5948:Gene family 5859:Tc1/mariner 5814:EnSpm/CACTA 5419:Biorobotics 5409:Biomimetics 5404:Biomedicine 4637:Polycentric 4627:Monocentric 4610:Holocentric 4605:Acrocentric 4600:Telocentric 4590:Metacentric 4468:Euchromatin 4428:chromosomes 3781:(1): 1300. 2955:: 223–245. 2656:: 158–169. 2545:? A review" 1336:Immortality 1287:Studies on 1270:In wildlife 1235:Measurement 1227:, or SASP ( 1131:needs more 925:Bombyx mori 904:Green algae 886:TTTTTTAGGG 827:Stylonychia 814:TTGGG(T/G) 791:Tetrahymena 767:Trypanosoma 682:Vertebrates 580:Lengthening 497:or D-loop. 415:vertebrates 403:vertebrates 322:prokaryotes 151:chromosomes 47:chromosomes 6023:Categories 5960:Pseudogene 5777:retroposon 5695:Transposon 5557:transposon 5374:Bioeconomy 5346:Stem cells 5299:Embryology 5222:Filtration 5212:Extraction 5131:Bioreactor 4789:Centromere 4720:Structures 4699:Polyploidy 4689:Aneuploidy 4490:Nucleosome 4480:Chromosome 3838:(1): 272. 3732:(9): e75. 3624:(1): 145. 3226:Aging Cell 1845:Aging Cell 1825:2008-06-22 1675:2012-06-12 1398:References 1351:Senescence 1326:Centromere 1289:ectotherms 1277:endotherms 1203:March 2018 1173:newspapers 1162:"Telomere" 960:Roundworms 851:Plasmodium 809:Paramecium 651:nucleotide 543:DNA damage 501:Shortening 478:base pairs 462:senescence 446:stem cells 442:germ cells 435:Telomerase 421:Telomerase 307:base pairs 254:telomerase 199:(end) and 167:DNA repair 159:eukaryotes 147:nucleotide 6044:Telomeres 5879:P element 5829:Harbinger 5570:Repeatome 5217:Fed Batch 5117:and tools 4741:Protamine 4648:Processes 4632:Dicentric 4485:Chromatid 4463:Chromatin 4444:Karyotype 4299:208319503 4283:1461-023X 4234:0962-1083 4193:226291119 4167:2054-5703 4120:237328316 4104:0962-1083 4037:0962-8436 3947:: e1727. 3640:1471-2105 3489:0305-1048 3446:206331112 3338:0305-1048 2977:209748557 2502:: 37–45. 2229:BioEssays 2194:(3): 19. 2188:MedGenMed 2110:0027-8424 1805:191854286 1601:0531-5565 1554:0022-5193 1499:0002-3264 1437:1476-5594 1367:G-quartet 1357:Tankyrase 1257:Flow-FISH 1021:TCTGGGTG 913:TTTTAGGG 846:protozoa 838:TTTTGGGG 821:Oxytricha 786:protozoa 773:Crithidia 762:protozoa 673:Organism 641:Sequences 368:Shelterin 326:bacterial 177:Discovery 155:Sequences 6003:Telomere 5969:See also 5909:Zisupton 5889:Polinton 5884:PiggyBac 5839:Helitron 5658:Helitron 5653:Polinton 5549:Genetics 5494:Category 5449:Virology 5351:Telomere 4998:Branches 4885:See also 4727:Telomere 4694:Euploidy 4622:Acentric 4519:allosome 4511:Autosome 4437:concepts 4348:29335373 4291:31773847 4242:33662151 4185:33391781 4112:34437736 4055:29335377 3969:44594597 3961:22415954 3907:20463557 3899:17406480 3864:31138115 3813:29358629 3756:24609383 3707:12000852 3658:33752601 3599:23833545 3507:36546771 3438:26716914 3397:25828846 3356:37602392 3347:10767889 3299:10309423 3291:21194798 3256:21518243 3207:13841086 3199:15315667 3149:35667874 3047:14315085 3012:13905658 2969:31900099 2934:30225068 2877:28394764 2828:22782639 2779:33504179 2736:35165420 2680:26853993 2628:19089916 2579:29212750 2526:29604323 2477:17012276 2420:10338214 2379:20826803 2259:11920124 2210:15520642 2169:15471900 2128:31285335 2061:37387314 2053:10784448 2010:27182535 1961:19589679 1867:20569239 1768:22661228 1617:26381790 1453:11726588 1445:20237481 1417:Oncogene 1299:See also 1081:GGTGTAC 994:Budding 976:Fission 874:TTTAGGG 833:Euplotes 797:Glaucoma 754:AG(1-8) 737:Didymium 731:Physarum 647:TeloBase 623:seabirds 512:in vitro 448:such as 411:ciliates 348:proteins 343:Borrelia 203:(part). 55:telomere 5899:Transib 5874:Novosib 5854:Kolobok 5824:Ginger2 5819:Ginger1 5804:Crypton 5506:Commons 5389:Biology 5282:Cloning 5060:Protein 5055:Plasmid 4963:History 4897:Plasmid 4751:Histone 4662:Meiosis 4657:Mitosis 4339:5784069 4176:7735339 4147:Bibcode 4046:5784070 3855:6540518 3804:5778012 3783:Bibcode 3747:4027178 3649:7986547 3591:9702772 3556:2664709 3498:9841428 3247:3387546 3179:Bibcode 3141:9454332 3121:Bibcode 3113:Science 3098:9440710 3090:7544491 3070:Bibcode 3062:Science 2925:6124068 2904:Bibcode 2868:5425118 2819:3480822 2727:8985209 2671:5590630 2619:2727686 2570:5746531 2543:in vivo 2517:6162185 2468:1636468 2370:2975205 2328:4360698 2320:6330571 2300:Bibcode 2251:2241933 2201:1435592 2119:6660761 2088:Bibcode 2033:Bibcode 2025:Science 2001:4863463 1926:2780561 1894:Bibcode 1759:3371406 1719:4754905 1699:Bibcode 1609:9415101 1562:4754905 1534:Bibcode 1507:5158754 1293:Metazoa 1187:scholar 1152:removed 971:TTAGGC 919:Insects 861:Higher 802:TTGGGG 784:Ciliate 778:TTAGGG 742:TTAGGG 719:TTAGGG 701:TTAGGG 696:Xenopus 615:Science 520:in vivo 482:guanine 399:guanine 289:3' ends 5998:CRISPR 5864:Merlin 5849:ISL2EU 5799:Academ 5632:repeat 5434:Mining 5367:fields 5026:Allele 4458:Genome 4449:Ploidy 4346:  4336:  4297:  4289:  4281:  4240:  4232:  4191:  4183:  4173:  4165:  4118:  4110:  4102:  4053:  4043:  4035:  3988:Nature 3967:  3959:  3905:  3897:  3862:  3852:  3811:  3801:  3754:  3744:  3705:  3698:115301 3695:  3656:  3646:  3638:  3597:  3589:  3554:  3547:318019 3544:  3505:  3495:  3487:  3444:  3436:  3395:  3354:  3344:  3336:  3297:  3289:  3254:  3244:  3205:  3197:  3147:  3139:  3096:  3088:  3045:  3010:  2975:  2967:  2932:  2922:  2875:  2865:  2826:  2816:  2777:  2734:  2724:  2678:  2668:  2626:  2616:  2577:  2567:  2524:  2514:  2475:  2465:  2428:721901 2426:  2418:  2377:  2367:  2326:  2318:  2292:Nature 2257:  2249:  2208:  2198:  2167:  2126:  2116:  2108:  2059:  2051:  2008:  1998:  1959:  1924:  1917:297991 1914:  1865:  1803:  1793:  1766:  1756:  1717:  1655:642006 1653:  1615:  1607:  1599:  1560:  1552:  1505:  1497:  1451:  1443:  1435:  1242:WALTER 1189:  1182:  1175:  1168:  1160:  996:yeasts 978:yeasts 930:TTAGG 893:Allium 863:plants 670:Group 472:Length 466:cancer 393:, and 340:, and 294:primer 251:enzyme 238:, and 45:Human 5904:Zator 5844:IS3EU 5749:LINE2 5744:LINE1 5736:LINEs 5713:SINEs 5669:Other 5458:Lists 5336:Omics 4735:TINF2 4504:Types 4435:Basic 4295:S2CID 4189:S2CID 4116:S2CID 3965:S2CID 3903:S2CID 3595:S2CID 3442:S2CID 3295:S2CID 3203:S2CID 3167:(PDF) 3145:S2CID 3094:S2CID 2973:S2CID 2847:Aging 2424:S2CID 2324:S2CID 2255:S2CID 2057:S2CID 1613:S2CID 1449:S2CID 1378:Notes 1194:JSTOR 1180:books 708:fungi 691:mouse 687:Human 230:with 201:meros 197:telos 153:(see 140:méros 133:μέρος 123:télos 116:τέλος 111: 5894:Sola 5869:MuDR 5809:Dada 5772:MER4 5767:HERV 5759:LTRs 5187:CSTR 5156:HPLC 5050:Gene 5031:Cell 4517:(or 4344:PMID 4287:PMID 4279:ISSN 4238:PMID 4230:ISSN 4181:PMID 4163:ISSN 4108:PMID 4100:ISSN 4051:PMID 4033:ISSN 3957:PMID 3895:PMID 3860:PMID 3809:PMID 3752:PMID 3703:PMID 3654:PMID 3636:ISSN 3587:PMID 3552:PMID 3503:PMID 3485:ISSN 3434:PMID 3393:PMID 3352:PMID 3334:ISSN 3287:PMID 3252:PMID 3195:PMID 3137:PMID 3086:PMID 3043:PMID 3008:PMID 2965:PMID 2930:PMID 2873:PMID 2824:PMID 2775:PMID 2732:PMID 2676:PMID 2624:PMID 2575:PMID 2522:PMID 2473:PMID 2416:PMID 2398:Cell 2375:PMID 2316:PMID 2247:PMID 2206:PMID 2165:PMID 2124:PMID 2106:ISSN 2049:PMID 2006:PMID 1957:PMID 1922:PMID 1863:PMID 1801:OCLC 1791:ISBN 1764:PMID 1715:PMID 1651:PMID 1605:PMID 1597:ISSN 1558:PMID 1550:ISSN 1503:PMID 1495:ISSN 1441:PMID 1433:ISSN 1166:news 1135:for 395:RAP1 391:TPP1 387:POT1 383:TIN2 379:TRF2 375:TRF1 309:per 244:2009 5834:hAT 5726:MIR 5227:PFR 5161:NMR 5040:RNA 5036:DNA 4769:H2B 4764:H2A 4334:PMC 4326:doi 4322:373 4269:doi 4220:doi 4171:PMC 4155:doi 4090:hdl 4082:doi 4041:PMC 4025:doi 4021:373 3992:doi 3949:doi 3945:344 3941:BMJ 3887:doi 3850:PMC 3840:doi 3799:PMC 3791:doi 3742:PMC 3734:doi 3693:PMC 3685:doi 3644:PMC 3626:doi 3579:doi 3542:PMC 3534:doi 3493:PMC 3477:doi 3424:doi 3383:doi 3342:PMC 3326:doi 3279:doi 3242:PMC 3234:doi 3187:doi 3129:doi 3117:279 3078:doi 3066:269 3035:doi 3000:doi 2957:doi 2920:PMC 2912:doi 2863:PMC 2855:doi 2814:PMC 2806:doi 2765:doi 2722:PMC 2714:doi 2666:PMC 2658:doi 2614:PMC 2606:doi 2602:124 2565:PMC 2557:doi 2512:PMC 2504:doi 2500:177 2463:PMC 2455:doi 2406:doi 2365:PMC 2355:doi 2351:285 2308:doi 2296:310 2237:doi 2196:PMC 2155:doi 2114:PMC 2096:doi 2084:116 2041:doi 2029:288 1996:PMC 1988:doi 1949:doi 1912:PMC 1902:doi 1853:doi 1754:PMC 1746:doi 1707:doi 1643:doi 1639:120 1589:doi 1542:doi 1491:201 1425:doi 1246:PCR 1231:). 299:RNA 82:ɪər 6025:: 5559:, 5555:, 5551:: 4812:C2 4807:C1 4779:H4 4774:H3 4759:H1 4729:: 4426:: 4342:. 4332:. 4320:. 4316:. 4293:. 4285:. 4277:. 4265:23 4263:. 4259:. 4236:. 4228:. 4216:31 4214:. 4210:. 4187:. 4179:. 4169:. 4161:. 4153:. 4141:. 4137:. 4114:. 4106:. 4098:. 4088:. 4078:31 4076:. 4072:. 4049:. 4039:. 4031:. 4019:. 4015:. 3990:. 3986:. 3963:. 3955:. 3943:. 3924:. 3901:. 3893:. 3881:. 3858:. 3848:. 3836:20 3834:. 3830:. 3807:. 3797:. 3789:. 3777:. 3773:. 3750:. 3740:. 3730:42 3728:. 3724:. 3701:. 3691:. 3681:30 3679:. 3675:. 3652:. 3642:. 3634:. 3622:22 3620:. 3616:. 3593:. 3585:. 3575:16 3573:. 3550:. 3540:. 3530:17 3528:. 3524:. 3501:. 3491:. 3483:. 3473:51 3471:. 3467:. 3454:^ 3440:. 3432:. 3420:85 3418:. 3414:. 3391:. 3379:82 3377:. 3373:. 3350:. 3340:. 3332:. 3322:52 3320:. 3316:. 3293:. 3285:. 3275:33 3273:. 3250:. 3240:. 3230:10 3228:. 3224:. 3201:. 3193:. 3185:. 3175:13 3173:. 3169:. 3143:. 3135:. 3127:. 3115:. 3092:. 3084:. 3076:. 3064:. 3041:. 3031:37 3029:. 3006:. 2996:25 2994:. 2971:. 2963:. 2953:41 2951:. 2928:. 2918:. 2910:. 2898:. 2894:. 2871:. 2861:. 2849:. 2845:. 2822:. 2812:. 2802:18 2800:. 2796:. 2773:. 2761:41 2759:. 2753:. 2730:. 2720:. 2710:24 2708:. 2702:. 2688:^ 2674:. 2664:. 2654:54 2652:. 2648:. 2636:^ 2622:. 2612:. 2600:. 2596:. 2573:. 2563:. 2553:13 2551:. 2547:. 2520:. 2510:. 2498:. 2494:. 2471:. 2461:. 2451:34 2449:. 2445:. 2422:. 2414:. 2402:97 2400:. 2396:. 2373:. 2363:. 2349:. 2345:. 2322:. 2314:. 2306:. 2294:. 2253:. 2245:. 2233:12 2231:. 2227:. 2204:. 2190:. 2186:. 2163:. 2151:26 2149:. 2145:. 2122:. 2112:. 2104:. 2094:. 2082:. 2078:. 2055:. 2047:. 2039:. 2027:. 2004:. 1994:. 1982:. 1978:. 1955:. 1945:19 1943:. 1920:. 1910:. 1900:. 1890:86 1888:. 1884:. 1861:. 1847:. 1843:. 1799:. 1762:. 1752:. 1742:26 1740:. 1736:. 1713:. 1705:. 1695:41 1693:. 1649:. 1637:. 1625:^ 1611:. 1603:. 1595:. 1585:31 1583:. 1579:. 1556:. 1548:. 1540:. 1530:41 1528:. 1524:. 1501:. 1489:. 1485:. 1447:. 1439:. 1431:. 1421:29 1419:. 1415:. 1154:. 830:, 824:, 794:, 770:, 734:, 693:, 689:, 389:, 385:, 381:, 377:, 334:, 313:. 256:. 173:. 103:-/ 94:iː 53:A 5615:) 5611:( 5602:/ 5541:e 5534:t 5527:v 5038:/ 4948:e 4941:t 4934:v 4872:T 4867:Q 4862:P 4857:O 4852:N 4847:M 4842:K 4837:J 4832:I 4827:H 4822:F 4817:E 4802:B 4797:A 4737:) 4733:( 4532:/ 4513:/ 4456:/ 4416:e 4409:t 4402:v 4350:. 4328:: 4301:. 4271:: 4244:. 4222:: 4195:. 4157:: 4149:: 4143:7 4122:. 4092:: 4084:: 4057:. 4027:: 4000:. 3994:: 3971:. 3951:: 3928:. 3909:. 3889:: 3883:1 3866:. 3842:: 3815:. 3793:: 3785:: 3779:8 3758:. 3736:: 3709:. 3687:: 3660:. 3628:: 3601:. 3581:: 3558:. 3536:: 3509:. 3479:: 3448:. 3426:: 3399:. 3385:: 3358:. 3328:: 3301:. 3281:: 3258:. 3236:: 3209:. 3189:: 3181:: 3151:. 3131:: 3123:: 3100:. 3080:: 3072:: 3049:. 3037:: 3014:. 3002:: 2979:. 2959:: 2936:. 2914:: 2906:: 2900:5 2879:. 2857:: 2851:9 2830:. 2808:: 2781:. 2767:: 2738:. 2716:: 2682:. 2660:: 2630:. 2608:: 2581:. 2559:: 2528:. 2506:: 2479:. 2457:: 2430:. 2408:: 2381:. 2357:: 2330:. 2310:: 2302:: 2261:. 2239:: 2212:. 2192:6 2171:. 2157:: 2130:. 2098:: 2090:: 2063:. 2043:: 2035:: 2012:. 1990:: 1984:5 1963:. 1951:: 1928:. 1904:: 1896:: 1869:. 1855:: 1849:9 1828:. 1807:. 1770:. 1748:: 1721:. 1709:: 1701:: 1678:. 1657:. 1645:: 1619:. 1591:: 1564:. 1544:: 1536:: 1509:. 1455:. 1427:: 1240:( 1205:) 1201:( 1191:· 1184:· 1177:· 1170:· 1144:. 629:( 143:) 137:( 126:) 120:( 100:ə 97:l 91:t 88:ˈ 85:, 79:m 76:ə 73:l 70:ɛ 67:t 64:ˈ 61:/ 57:( 38:. 20:)

Index

Telomere shortening
Telomere (insect morphology)
Telomere (disambiguation)

chromosomes
/ˈtɛləmɪər,ˈtlə-/
Ancient Greek
τέλος
μέρος
nucleotide
chromosomes
Sequences
eukaryotes
chromosomal DNA
DNA repair
double-strand break
Hermann Joseph Muller
Drosophila melanogaster
Barbara McClintock
Alexey Olovnikov
Leonard Hayflick
somatic cell
Elizabeth Blackburn
Yale University
Joseph G. Gall
Carol Greider
Jack Szostak
2009
Nobel Prize in Physiology or Medicine
enzyme

Text is available under the Creative Commons Attribution-ShareAlike License. Additional terms may apply.