Haplogroup I-M170 - Knowledge

4704: 394:(LGM), which lasted from 26,500 years ago until approximately 19,500 years ago. TMRCA is an estimate of the time of subclade divergence. Rootsi and colleagues in 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I-M170 they estimate time to STR variation as 24,000 ±7,100 years ago and time to population divergence as 23,000 ±7,700 years ago. These estimates are consistent with those of Karafet 2008 cited above. However, Underhill and his colleagues calculate the time to subclade divergence of I1 and I2 to be 28,400 ±5,100 years ago, although they calculate the STR variation age of I1 at only 8,100 ±1,500 years ago. 8574: 147: 304: 43: 5504: 315: 4604:, despite the much lower overall frequency of Haplogroup I1-M253 among the modern French and Italian populations. This, along with the structure of the phylogenetic tree of I1-M253 strongly suggests that most living I1 males are the descendants of an initially small group of reproductively successful men who lived in Scandinavia during the Nordic Bronze Age. 85: 4743:, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I1-M253; the lack of correlation between the distributions of I1-M253 and I2a2-M436 in Fennoscandia may be a result of Haplogroup I2a2-M436's being more strongly affected in the earliest settlement of this region by 4592:, distribution of Haplogroup I1-M253 is closely correlated with that of Haplogroup I2a2-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I-M170 Y-chromosomes are I1-M253. Another characteristic of the Scandinavian I1-M253 Y-chromosomes is their rather low 8183:

Haber, Marc; Platt, Daniel E.; Ashrafian Bonab, Maziar; Youhanna, Sonia C.; Soria-Hernanz, David F.; Martínez-Cruz, Begoña; Douaihy, Bouchra; Ghassibe-Sabbagh, Michella; Rafatpanah, Hoshang; Ghanbari, Mohsen; Whale, John; Balanovsky, Oleg; Wells, R. Spencer; Comas, David; Tyler-Smith, Chris; Zalloua,

5778:

P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography

5152:

Rootsi Siiri; Kivisild, Toomas; Benuzzi, Giorgia; Help, Hela; Bermisheva, Marina; Kutuev, Ildus; Barać, Lovorka; Peričić, Marijana; Balanovsky, Oleg; Pshenichnov, Andrey; Dion, Daniel; Grobei, Monica; Zhivotovsky, Lev A.; Battaglia, Vincenza; Achilli, Alessandro; Al-Zahery, Nadia; Parik, Jüri; King,

489:

is shown by the common phylogenetic origins of both haplogroups I and J in the parent haplogroup IJ (M429). This common ancestry suggests that the subclades of IJ entered the Balkans from Anatolia or the Caucasus, some time before the Last Glacial Maximum. I and J were subsequently distributed in

490:

Asia and Europe in a disjunctive phylogeographic pattern typical of "sibling" haplogroups. A natural geographical corridor like the Balkans is likely to have been used later by members of other subclades of IJ, as well as other haplogroups, including those associated with Early European Farmers.

4683:

in France than among the population of ethnic Basques. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.

4807:

in Eastern Europe. One subclade of Haplogroup I2a2-M436, namely I2a2a1a1-M284, has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of

256:

Haplogroup I most likely arose in Europe, with it so far found in Palaeolithic sites throughout Europe, but not outside it. It diverged from common ancestor IJ* about 43,000 years ago. Early evidence for haplogroup J has been found in the Caucasus and Iran. In addition, living examples of the

9233:

K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. See: Poznik

5454:

Posth, Cosimo; Yu, He; Ghalichi, Ayshin; Rougier, Hélène; Crevecoeur, Isabelle; Huang, Yilei; Ringbauer, Harald; Rohrlach, Adam B.; Nägele, Kathrin; Villalba-Mouco, Vanessa; Radzeviciute, Rita; Ferraz, Tiago; Stoessel, Alexander; Tukhbatova, Rezeda; Drucker, Dorothée G. (2023-03-01).

4727:(up to 71%, avg. 40-50%). Its subclade I-L161 has greater variance in Ireland and Great Britain, but overall frequency is very low (2–3%), while subclade I-L162 has the highest variance and also high concentration in Eastern Europe (Ukraine, Southeastern Poland, Belarus). 7551:

Bosch, E.; Calafell, F.; Gonzalez-Neira, A.; Flaiz, C; Mateu, E; Scheil, HG; Huckenbeck, W; Efremovska, L; et al. (2006). "Paternal and maternal lineages in the Balkans show a homogeneous landscape over linguistic barriers, except for the isolated Aromuns".

4561:(M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically 6312: 6020:

Nasidze Ivan; Ling, E. Y. S.; Quinque, D.; Dupanloup, I.; Cordaux, R.; Rychkov, S.; Naumova, O.; Zhukova, O.; Sarraf-Zadegan, N.; Naderi, G. A.; Asgary, S.; Sardas, S.; Farhud, D. D.; Sarkisian, T.; Asadov, C.; Kerimov, A.; Stoneking, M. (2004).

4836:. This suggestion is supported by recent genetic studies regarding Y-DNA Haplogroup I2b2-L38 have concluded that there was some Late Iron Age migration of Celtic La Tène people, through Belgium, to the British Isles including north-east Ireland. 5153:

Roy; Cinnioğlu, Cengiz; Khusnutdinova, Elsa; Rudan, Pavao; Balanovska, Elena; Scheffrahn, Wolfgang; Simonescu, Maya; Brehm, Antonio; Goncalves, Rita; Rosa, Alexandra; Moisan, Jean-Paul; Chaventre, Andre; Ferak, Vladimir; et al. (2004).

413:

cultures. Rootsi and colleagues in 2004 suggested that each of the ancestral populations now dominated by a particular subclade of Haplogroup I-M170 experienced an independent population expansion immediately after the Last Glacial Maximum.

390:) for I-M170 was estimated by Karafet and colleagues in 2008 to be 22,200 years ago, with a confidence interval between 15,300 and 30,000 years ago. This would make the founding event of I-M170 approximately contemporaneous with the 4707:

The approximate frequency and variance distribution of haplogroup I-P37 clusters, ancestral "Dnieper-Carpathian" (DYS448=20) and derived "Balkan" (DYS448=19: represented by a single SNP I-PH908), in Eastern Europe per O.M. Utevska

7655:

Cinnioğlu, Cengiz; King, Roy; Kivisild, Toomas; Kalfoğlu, Ersi; Atasoy, Sevil; Cavalleri, Gianpiero L.; Lillie, Anita S.; Roseman, Charles C.; Lin, Alice A. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia".

7893:

Allentoft, Morten E.; Sikora, Martin; Sjögren, Karl-Göran; Rasmussen, Simon; Rasmussen, Morten; Stenderup, Jesper; Damgaard, Peter B.; Schroeder, Hannes; Ahlström, Torbjörn; Vinner, Lasse; Malaspinas, Anna-Sapfo (June 2015).

7957:

Malmström, Helena; Gilbert, M. Thomas P.; Thomas, Mark G.; Brandström, Mikael; Storå, Jan; Molnar, Petra; Andersen, Pernille K.; Bendixen, Christian; Holmlund, Gunilla; Götherström, Anders; Willerslev, Eske (2009-11-03).

5643:

Teschler-Nicola, Maria; Fernandes, Daniel; Händel, Marc; Einwögerer, Thomas; Simon, Ulrich; Neugebauer-Maresch, Christine; Tangl, Stefan; Heimel, Patrick; Dobsak, Toni; Retzmann, Anika; Prohaska, Thomas (2020-11-06).

6797:

Lappalainen, Tuuli; Koivumäki, Satu; Salmela, Elina; Huoponen, Kirsi; Sistonen, Pertti; Savontaus, Marja-Liisa; Lahermo, Päivi (19 July 2006). "Regional differences among the Finns: A Y-chromosomal perspective".

4511:(1/176), even though I-M170 occurs at only very low frequencies among modern populations of these regions as a whole. This is consistent with the belief that the haplogroup first appeared in South West Eurasia. 6316: 7517: 7301:

Zgonjanin D, Alghafri R, Antov M, Stojiljković G, Petković S, Vuković R, Drašković D (November 2017). "Genetic characterization of 27 Y-STR loci with the Yfiler Plus kit in the population of Serbia".

6094:

Haber, Marc; Platt, Daniel E.; Bonab, Maziar Ashrafian; Youhanna, Sonia C.; Soria-Hernanz, David F.; Martínez-Cruz, Begoña; Douaihy, Bouchra; Ghassibe-Sabbagh, Michella; Rafatpanah, Hoshang (2012).

8087: 9069: 7233:

Martinez-Cruz B, Ioana M, Calafell F, Arauna LR, Sanz P, Ionescu R, Boengiu S, Kalaydjieva L, Pamjav H, Makukh H, Plantinga T, van der Meer JW, Comas D, Netea MG (2012). Kivisild T (ed.).

4537:(Neither study from which the above figures were drawn excluded the present I2-M438 clade as a whole, but only certain subclades, so these presumed cases I* may possibly belong to I2.) 295:

expanded westwards from the far corner of Eastern Europe, likely Russia, to Central Europe. They are associated with a genetic cluster that is normally called the Věstonice cluster.

6482: 7145:Вестник Московского университета. Серия XXIII АНТРОПОЛОГИЯ № 1/2014: 96–101СВЯЗЬ ИЗМЕНЧИВОСТИ Y ХРОМОСОМЫ И РОДОВОЙСТРУКТУРЫ: ГЕНОФОНД СТЕПНОЙ АРИСТОКРАТИИИ ДУХОВЕНСТВА КАЗАХОВ 7541:

Y-chromosome distributions among populations in Northwest China identify significant contribution from Central Asian pastoralists and lesser influence of western Eurasians (2010)

7338:"Distribution of Y-chromosome haplogroups in Serbian population groups originating from historically and geographically significant distinct parts of the Balkan Peninsula" 4703: 4163:

Haplogroup I1 (L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157, L186, L187, M253, M307.2/P203.2, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111)

4492:

contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

5793:

Semino O, Passarino G, Oefner PJ, et al. (November 2000). "The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective".

6502:

Karachanak S, Grugni V, Fornarino S, Nesheva D, Al-Zahery N, Battaglia V, Carossa V, Yordanov Y, Torroni A, Galabov AS, Toncheva D, Semino O (2013). Pereira LM (ed.).

8243:

Grasgruber, Pavel; Popović, Stevo; Bokuvka, Dominik; Davidović, Ivan; Hřebíčková, Sylva; Ingrová, Pavlína; Potpara, Predrag; Prce, Stipan; Stračárová, Nikola (2017).

6409:

Battaglia, Vincenza; Fornarino, Simona; Al-Zahery, Nadia; Olivieri, Anna; Pala, Maria; Myres, Natalie M; King, Roy J; Rootsi, Siiri; et al. (24 December 2008).

9096:

Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome".

8401: 8388: 5938: 6690:

El-Sibai, Mirvat; Platt, Daniel E.; Haber, Marc; Xue, Yali; Youhanna, Sonia C.; Wells, R. Spencer; Izaabel, Hassan; Sanyoura, May F.; Harmanani, Haidar (2009).

6977:

Sanchez, J.J.; Børsting, C.; Hernandez, A.; Mengel-Jørgensen, J.; Morling, N. (April 2004). "Y chromosome SNP haplogroups in Danes,Greenlanders and Somalis".

7521: 4918:, R1b-U106, I2a1b-M423 and tall males. The study featured the measured average heights of young German, Swedish, Dutch, Danish, Serbian and Bosnian men. The 5865:

Fu, Qiaomei; Posth, Cosimo; Hajdinjak, Mateja; Petr, Martin; Mallick, Swapan; Fernandes, Daniel; Furtwängler, Anja; Haak, Wolfgang; Meyer, Matthias (2016).

7777:

Rootsi, Siiri; Magri, Chiara; Kivisild, Toomas; Benuzzi, Giorgia; Help, Hela; Bermisheva, Marina; Kutuev, Ildus; Barać, Lovorka; Peričić, Marijana (2004).

421:

European human remains make it one of the most frequent haplogroup from that period. In 2016, the 31,210–34,580-year-old remains of a hunter-gatherer from

59: 281: 6960: 4138:

of Haplogroup I-M170 with their defining mutations, as of 2011. Up-to-date phylogenetic trees listing all currently known subclades of I can be found at

5595:

Bennett, E. Andrew; Prat, Sandrine; Péan, Stéphane; Crépin, Laurent; Yanevich, Alexandr; Puaud, Simon; Grange, Thierry; Geigl, Eva-Maria (2019-07-02).

4651:

Haplogroup I2a1a-M26 is practically absent east of France and Italy, while it is found at low but significant frequencies outside of Sardinia in the

351:(Haplogroup C-F3393). K2a and C1 have been found in the oldest sequenced male remains from Western Eurasia (dating from circa 45,000 to 35,000 years 8502: 7408:

Adams et al. The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula

4350:

I2a2a L34/PF3857/S151, L36/S152, L59, L368, L622, M223, P219/PF3859/S24, P220/S119, P221/PF3858/S120, P222/PF3861/U250/S118, P223/PF3860/S117, Z77

505:(M89), supports the inference that haplogroups IJ and K both arose in Southwestern Asia. Living carriers of F* and IJ* have been reported from the 8144: 4479:

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer.

8485: 7728:

Caciagli, Laura; Bulayeva, Kazima; Bulayev, Oleg; Bertoncini, Stefania; Taglioli, Luca; Pagani, Luca; Paoli, Giorgio; Tofanelli, Sergio (2009).

9074: 375:

WA3 (lower Austria), dating from circa 33,000-24,000 BP. At the same site, two twin boys were also found, both were assigned to haplogroup I*.

106: 93: 4755:. Haplogroup I2a2-M436 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including 8167: 4660: 8373: 8363: 8062: 6876:"Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis" 7118:

Genetic Structure in Contemporary South Tyrolean Isolated Populations Revealed by Analysis of Y-Chromosome, mtDNA, and Alu Polymorphisms

6874:

Kayser, Manfred; Lao, Oscar; Anslinger, K; Augustin, Christa; Bargel, G.; Edelmann, J; Elias, Sahar; Heinrich, M; Henke, Jürgen (2005).

5120: 4671:

in North Africa, Great Britain, and Ireland. Haplogroup I2a1a-M26 appears to be the only subclade of Haplogroup I-M170 found among the

4956: 433:

1b have been documented, once each, on older remains in Europe. I2 subclade of I-M170 is the main haplogroup found on male remains in

4751:

due to its rarity, as Haplogroup I2a2-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of

8558: 5839: 226: 124: 6367:"High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations" 6005:ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ НАРОДОВ ЗАПАДНОГО КАВКАЗА ПО ДАННЫМ О ПОЛИМОРФИЗМЕ Y-ХРОМОСОМЫ, МИТОХОНДРИАЛЬНОЙ ДНК И ALU-ИНСЕРЦИЙ 9293: 5001: 4939: 1096: 1035: 8548: 8379: 8368: 6747: 4633: – some 15,000–17,000 years ago and developed into three main subgroups : I2-M438*, I2a-L460, I2b-L415 and I2c-L596. 1043: 8493: 6561: 6461:

Karachanak, Sena; Fornarino, Simona; Grugni, Viola; Semino, Ornella; Toncheva, Draga; Galabov, Angel; Atanasov, Boris (2009).

8507: 8443: 4565:-influenced world. A notable exception is Finland, where frequency in West Finns is up to 40%, and in certain provinces like 6022: 7091:

Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects

4544:

male from Afghanistan has also been found to carry I*, with all known subclades of both I1 (M253) and I2 (M438) ruled out.

6668:

Altena, E., Smeding, R., van der Gaag, K.J. et al. The Dutch Y-chromosomal landscape. Eur J Hum Genet 28, 287–299 (2020).

6488: 4886:

This haplogroup reaches its maximum frequency in the Western Balkans (with the highest concentration of I2 in present-day

4715:

is the most frequent Y-chromosome haplogroup I-M170 in Central and Eastern European populations, reaching its peak in the

4644:

is notable for its strong presence in Sardinia. Haplogroup I-M170 comprises approximately 40% of all patrilines among the

364: 7027:"The western and eastern roots of the Saami--the story of genetic "outliers" told by mitochondrial DNA and Y chromosomes" 6929: 2840: 8398: 8385: 5528:

Mounier, Aurélien; Heuzé, Yann; Samsel, Mathilde; Vasilyev, Sergey; Klaric, Laurent; Villotte, Sébastien (2020-12-14).

343:

Available evidence suggests that I-M170 was preceded into areas in which it would later become dominant by haplogroups

7336:

Mihajlovic, Milica; Tanasic, Vanja; Markovic, Milica Keckarevic; Kecmanovic, Miljana; Keckarevic, Dusan (2022-11-01).

4676: 4656: 387: 8136:Генофонд українців за різними системами генетичних маркерів: походження і місце на європейському генетичному просторі 4808:

Haplogroup I1-M253 and Haplogroup I2a2-M436 seem to correlate fairly well with the extent of historical influence of

7127:

Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome

7187:

Pliss et al. Y-Chromosomal Lineages of Latvians in the Contextof the Genetic Variation of the Eastern-Baltic Region

3882: 2814: 608: 9215:

Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure.

8063:"Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe figure 1" 7595:

Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (May 2008).

8486:

YCC Haplogroup I page – I1a (now considered I-M253), I1b (now considered I-P37.2) and I1c (now considered I-M223)

8470: 5203: 8141:

The gene pool of Ukrainians revealed by different systems of genetic markers: the origin and statement in Europe

405:, was found in human remains belonging to the previously mentioned Gravettian culture and in individuals of the 8737: 7470:"Phylogeography of Y-chromosome haplogroup I-M170 reveals distinct domains of prehistoric gene flow in europe" 7417:

Y-Chromosome Variation Among Sudanese: Restricted Gene Flow, Concordance With Language, Geography, and History

5155:"Phylogeography of Y-Chromosome Haplogroup I-M170 Reveals Distinct Domains of Prehistoric Gene Flow in Europe" 4914:. A 2014 study examining the correlation between Y-DNA haplogroups and height found a correlation between the 4347:

I2a2 L35/PF3862/S150, L37/PF6900/S153, L181, M436/P214/PF3856/S33, P216/PF3855/S30, P217/PF3854/S23, P218/S32

8677: 6833:

Ramos-Luis, E.; Blanco-Verea, A.; Brión, M.; Van Huffel, V.; Carracedo, A.; Sánchez-Diz, P. (December 2009).

6254: 9261:

Haplogroup S, as of 2017, is also known as K2b1a. (Previously the name Haplogroup S was assigned to K2b1a4.)

8940: 8667: 8475: 4833: 397:

Semino (2000) speculated that the initial dispersion of this population corresponds to the diffusion of the

9270:

Haplogroup M, as of 2017, is also known as K2b1b. (Previously the name Haplogroup M was assigned to K2b1d.)

8764: 8747: 5954:"Nuclear and Mitochondrial DNA Analysis of a 2,000-Year-Old Necropolis in the Egyin Gol Valley of Mongolia" 5340:"Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians" 5060: 8929: 8921: 8661: 8526: 7960:"Ancient DNA Reveals Lack of Continuity between Neolithic Hunter-Gatherers and Contemporary Scandinavians" 4832:, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of 4625:, may have originated in southern Europe – it is now found at its highest frequencies in the western 4596:

diversity (STR diversity): a greater variety of Haplogroup I1-M253 Y-chromosomes has been found among the

1088: 1057: 1026: 445: 344: 234: 8755: 7779:"Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe" 6410: 5069:"Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in Europe" 8991: 8837: 8433: 7235:"Y-chromosome analysis in individuals bearing the Basarab name of the first dynasty of Wallachian kings" 6692:"Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast" 4966: 4961: 4812:. The punctual presence of both haplogroups at a low frequency in the area of the historical regions of 4159: 230: 202: 198: 187: 8914: 8907: 8900: 5059:

Bennett, E.A., Prat, S., Péan, S., Crépin, L., Yanevich, A., Puaud, S., ... & Geigl, E. M. (2019).

4739:(M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in 7003:

Presence of three different paternal lineages among North Indians: a study of 560 Y chromosomes (2009)

6650:

Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast

9030: 8949: 8884: 8828: 8813: 8799: 8720: 8692: 8256: 8197: 8088:"The peopling of modern Bosnia-Herzegovina: Y-chromosome haplogroups in the three main ethnic groups" 7907: 7847: 7337: 7246: 6515: 6244:

Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape

6174: 6107: 5878: 5802: 5737: 5541: 5410: 5351: 5288:"New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree" 5239: 4981: 4971: 1321: 470:

In one instance, haplogroup I was found far from Europe, among 2,000-year-old remains from Mongolia.

457: 449: 430: 426: 402: 391: 319: 31: 9023: 9018: 7136:

Isolates in a corridor of migrations: A high-resolution analysis of Y-chromosome variation in Jordan

6462: 4898:

of the range 180 cm (5 ft 11 in)–182 cm (6 ft 0 in) in the cantons of

8541: 8423: 7214:

Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan (2006)

4688: 2304: 474: 250: 8411: 7730:"The key role of patrilineal inheritance in shaping the genetic variation of Dagestan highlanders" 7178:

The dual origin of tati-speakers from dagestan as written in the genealogy of uniparental variants

7082:

Uniparental Markers in Italy Reveal a Sex-Biased Genetic Structure and Different Historical Strata

9121: 8959: 8633: 8616: 8115: 8069: 8007:

Karlsson, Andreas O.; Wallerström, Thomas; Götherström, Anders; Holmlund, Gunilla (August 2006).

7939: 7689: 7626: 7577: 7373: 7100:

Traces of forgotten historical events in mountain communities in Central Italy: A genetic insight

6911: 6856: 6053: 5761: 5612: 5530:"Gravettian cranial morphology and human group affinities during the European Upper Palaeolithic" 5108: 5034: 4724: 4504: 1795: 1771: 1632: 348: 258: 7109:

Uniparental Markers of Contemporary Italian Population Reveals Details on Its Pre-Roman Heritage

6348:ВКЛАД ОТДЕЛЬНЫХ ПОЛЕССКИХ ПОПУЛЯЦИЙ И ПОПУЛЯЦИИ БЕЛОРУССКИХ ТАТАР В ГЕНОФОНД НАСЕЛЕНИЯ БЕЛАРУСИ 5939:"Ancient DNA reveals 'genetic continuity' between Stone Age and modern populations in East Asia" 467:

is from Neolithic Hungary, although it must have separated from I2 at an earlier point in time.

360: 4569:

more than 50%. I1 is believed to have become common as a result of a founder effect during the

9190: 9171:

F-Y27277, sometimes known as F2'4, is both the parent clade of F2 and F4 and a child of F-M89.

9113: 9051: 9046: 9037: 8980: 8971: 8891: 8862: 8780: 8732: 8650: 8513: 8331: 8323: 8282: 8225: 8163: 8107: 8038: 8030: 7989: 7981: 7931: 7923: 7875: 7816: 7798: 7759: 7751: 7681: 7673: 7618: 7569: 7499: 7450: 7365: 7357: 7318: 7274: 7056: 6954: 6903: 6895: 6815: 6729: 6711: 6608: 6543: 6474: 6443: 6388: 6349: 6339:Кутуев Ильдус Альбертович. Генетическая структура и молекулярная филогеография народов кавказа 6202: 6161:

Haber, M; Platt, DE; Ashrafian Bonab, M; Youhanna, SC; Soria-Hernanz, DF; et al. (2012).

6143: 6125: 6045: 5983: 5920: 5902: 5818: 5753: 5685: 5667: 5577: 5559: 5486: 5436: 5379: 5317: 5265: 5184: 5100: 5026: 4613: 4570: 4553: 4515: 4305: 3052: 3034: 2579: 2491: 2086: 1982: 418: 356: 280:, which is at least 31,000 years old, however, in a later study this was changed, and instead 242: 238: 7015:

Influences of history, geography, and religion on genetic structure: the Maronites in Lebanon

5703: 291:

Haplogroup I has been found in multiple individuals belonging to the Gravettian culture. The

9105: 9013: 8771: 8725: 8313: 8272: 8264: 8245:"The mountains of giants: An anthropometric survey of male youths in Bosnia and Herzegovina" 8215: 8205: 8186:"Afghanistan's ethnic groups share a Y-chromosomal heritage structured by historical events" 8099: 8020: 7971: 7915: 7865: 7855: 7806: 7790: 7741: 7665: 7608: 7561: 7489: 7481: 7440: 7349: 7310: 7264: 7254: 7046: 7038: 6986: 6887: 6846: 6807: 6719: 6703: 6598: 6588: 6533: 6523: 6433: 6425: 6378: 6192: 6182: 6163:"Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events" 6133: 6115: 6096:"Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events" 6037: 5973: 5965: 5910: 5894: 5886: 5810: 5745: 5675: 5657: 5604: 5567: 5549: 5476: 5468: 5426: 5418: 5369: 5359: 5307: 5299: 5255: 5247: 5174: 5166: 5090: 5080: 5016: 4809: 4768: 4652: 4574: 4562: 4523: 4495:

Several I* individuals, who do not fall into any known subclades, have been found among the

4170: 3716: 3712: 881: 502: 8785: 8497: 8405: 8392: 5287: 4821: 4772: 4716: 4675:, but appears to be found at somewhat higher frequencies among the general populations of 4496: 4040: 4032: 3998: 3994: 3797: 3401: 2832: 2805: 2783: 2695: 2669: 2053: 2035: 2017: 2000: 1973: 1175: 1123: 506: 498: 270: 246: 7427:

Karlsson, Andreas O; Wallerstrom, Thomas; Gotherstrom, Anders; Holmlund, Gunilla (2006).

6680:

ZONEN VAN ADAM IN NEDERLAND Genetische genealogie : een zoektocht in ons DNA-archief

5843: 5597:"The origin of the Gravettians: genomic evidence from a 36,000-year-old Eastern European" 4143: 3944: 1325: 8587:

Please help update this article to reflect recent events or newly available information.

8448: 8260: 8201: 7911: 7851: 7250: 6519: 6178: 6111: 5882: 5806: 5741: 5545: 5414: 5355: 5243: 4906:, 182 cm (6 ft 0 in)–186 cm (6 ft 1 in) in the cantons of 9001: 8794: 8627: 8534: 8453: 8277: 8244: 8220: 8185: 7870: 7835: 7811: 7778: 7494: 7469: 7269: 7234: 7051: 7026: 6724: 6691: 6603: 6538: 6503: 6438: 6197: 6162: 6138: 6095: 5978: 5953: 5915: 5866: 5680: 5645: 5572: 5529: 5431: 5398: 5374: 5339: 5312: 5260: 5227: 5179: 5154: 5061:

The origin of the Gravettians: genomic evidence from a 36,000-year-old Eastern European

4744: 4601: 4174: 3952: 3730: 3700: 3691: 3640: 3299: 2854: 1545: 1500: 1482: 1264: 494: 438: 352: 323: 285: 9138: 6990: 5630: 5042: 30:

This article is about the human Y-DNA haplogroup. For the human mtDNA haplogroup, see

9287: 9194: 8876: 8870: 8856: 8845: 8808: 8711: 8706: 8697: 8683: 8644: 8369:

Frequency Distributions of Y-DNA Haplogroup I and its subclades – with Video Tutorial

8302:"The role of nutrition and genetics as key determinants of the positive height trend" 8134: 8103: 7613: 7596: 7565: 7390:

The genetic structure of the Slovak population revealed by Y-chromosome polymorphisms

7377: 6707: 6411:"Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe" 6041: 5728:

Clark PU, Dyke AS, Shakun JD, et al. (August 2009). "The Last Glacial Maximum".

5616: 5456: 4915: 4844: 4800: 4748: 4672: 4597: 4541: 4519: 4052: 3215: 3101: 3016: 2985: 2623: 2078: 1956: 1935: 1646: 1615: 1586: 1572: 1070: 916: 711: 681: 658: 464: 422: 266: 9125: 8119: 7693: 7630: 7581: 6915: 6875: 6860: 6057: 5038: 303: 146: 8490: 8438: 7943: 5765: 5596: 5112: 4927: 4895: 4891: 4763:, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of 4752: 4740: 4589: 3811: 3580: 3562: 3532: 3273: 3109: 2184: 2176: 2158: 2140: 1881: 1823: 1411: 1393: 1189: 945: 372: 5814: 8480: 8210: 7860: 7353: 7314: 7259: 6851: 6834: 6528: 6313:"Comments on 2014 Klyosov Article on Jewish DNA Genealogy p. 1 of 2 - Levite DNA" 6187: 6120: 6061: 5364: 5126: 8518: 7643: 5286:

Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (2008).

4976: 4907: 4887: 4578: 4531: 4527: 4166: 4152:( L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, Page123, U179) 4100: 3256: 3207: 2730: 2636: 2308: 1943: 1268: 1004: 981: 848: 702: 672: 650: 627: 604: 582: 406: 379: 368: 308: 8143:] (PhD) (in Ukrainian). National Research Center for Radiation Medicine of 6811: 5662: 5554: 5472: 8458: 8428: 8318: 8301: 7976: 7959: 7895: 7669: 7291:

Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions.

6936: 6891: 5779:

and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.),

4986: 4951: 4840: 4645: 3906: 3890: 3784: 3766: 3392: 2942: 2611: 2414: 2396: 2266: 1917: 1899: 1659: 1375: 1357: 1149: 1114: 631: 564: 546: 434: 398: 292: 9246: 8327: 8034: 7985: 7927: 7802: 7755: 7677: 7361: 6899: 6715: 6504:"Y-chromosome diversity in modern Bulgarians: new clues about their ancestry" 6478: 6129: 5906: 5671: 5563: 5490: 5457:"Palaeogenomics of Upper Palaeolithic to Neolithic European hunter-gatherers" 8357: 8025: 8008: 7707: 7445: 7428: 7196:

Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events

6669: 6593: 6383: 6366: 5749: 5021: 4593: 4566: 4116: 4056: 4048: 4006: 3956: 3948: 3936: 3918: 3914: 3910: 3874: 3674: 3657: 3544: 3540: 3415: 3219: 3153: 3126: 2907: 2889: 2872: 2818: 2300: 2062: 1713: 1695: 1527: 1464: 1447: 1429: 928: 899: 864: 831: 809: 787: 762: 740: 453: 9117: 8335: 8286: 8229: 8111: 8042: 7993: 7935: 7879: 7820: 7763: 7685: 7622: 7573: 7503: 7454: 7369: 7322: 7278: 7060: 6907: 6819: 6733: 6612: 6576: 6547: 6447: 6392: 6206: 6147: 6049: 5987: 5924: 5822: 5757: 5689: 5646:"Ancient DNA reveals monozygotic newborn twins from the Upper Palaeolithic" 5581: 5440: 5383: 5321: 5269: 5188: 5104: 5030: 314: 6429: 5898: 245:

can be found in most present-day European populations, with peaks in some

7223:

Micro-Phylogeographic and Demographic History of Portuguese Male Lineages

5095: 4903: 4813: 4804: 4796: 4780: 4764: 4760: 4756: 4720: 4692: 4680: 4664: 4630: 4500: 4180: 4135: 4112: 3968: 3960: 3708: 3704: 3589: 3548: 3475: 3424: 3320: 3312: 3290: 3239: 3235: 3231: 3227: 3223: 3171: 3002: 2968: 2678: 2652: 2567: 2426: 2375: 2355: 2321: 2292: 2258: 2249: 2227: 2218: 2205: 2197: 2070: 1847: 1843: 1827: 1677: 1628: 1624: 1594: 1509: 1313: 1207: 1167: 1100: 1039: 723: 719: 486: 482: 371:(Belgium) C1a. The oldest I-M170 found is that of an individual known as 262: 9153:

Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4).

8268: 7919: 7746: 7729: 5890: 5422: 5251: 4695:

trade or a regular maritime exchange of some of metallurgical products.

473:

It would seem to be that separate waves of population movement impacted

9109: 5481: 5303: 5002:"Y chromosomal heritage of Croatian population and its island isolates" 4919: 4817: 4784: 4668: 4626: 4582: 4104: 4096: 4044: 4036: 4014: 4002: 3894: 3622: 3605: 3471: 3450: 3428: 3374: 3199: 3065: 2924: 2764: 2747: 2619: 2474: 2383: 2262: 2082: 2074: 2066: 1986: 1835: 1819: 1748: 1744: 1731: 1602: 1563: 1309: 1135: 1131: 1012: 990: 963: 748: 478: 410: 9239: 9193:

was known as "Haplogroup K2". That name has since been re-assigned to

6783: 4890:). It may be associated with unusually tall males, since those in the 17: 9250:, 2017, "Details of the Y-SNP markers included in the minimal Y tree" 7836:"Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge" 4923: 4911: 4899: 4829: 4792: 4788: 4776: 4108: 4060: 4010: 3990: 3972: 3964: 3940: 3902: 3898: 3886: 3878: 3855: 3536: 3523: 3506: 3489: 3462: 3343: 3339: 3243: 3211: 3203: 3135: 3061: 2998: 2994: 2955: 2791: 2713: 2593: 2575: 2509: 2441: 2363: 2341: 2337: 2333: 2278: 2270: 2235: 2231: 2122: 2104: 1839: 1815: 1791: 1762: 1740: 1300: 1282: 1256: 1243: 1225: 1074: 1066: 908: 817: 795: 727: 715: 685: 586: 383: 177: 8086:

Marjanovic D, Fornarino S, Montagna S, et al. (November 2005).

9206:

Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.

7794: 7485: 7042: 6284: 6226:

Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge

6015: 6013: 6011: 5969: 5608: 5170: 5085: 5068: 212:

L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, U179

8360:

from the International Society of Genetic Genealogy (ISOGG)of 2013

6258: 5147: 5145: 5143: 4935: 4931: 4825: 4702: 4092: 3847: 3829: 3442: 3356: 3331: 3179: 3113: 3083: 3069: 2545: 2527: 2422: 2329: 2274: 1851: 1831: 1655: 1513: 1339: 1127: 501:(M9) – and its evolutionary distance from other subclades of 277: 7205:

Paternal lineages in Libya inferred from Y-chromosome haplogroups

5067:

Rootsi, S, Kivisild, T, Benuzzi, G, Help, H, et al. (2019).

4139: 276:

The oldest example found was originally that of Paglicci133 from

257:

precursor Haplogroup IJ* have been found only in Iran, among the

8300:

Grasgruber, P.; Cacek, J.; Kalina, T.; Sebera, M. (2014-12-01).

5631:

Genomic structure in Europeans dating back at least 36,200 years

4508: 3793: 3593: 3139: 2951: 2682: 2553: 2090: 1663: 1598: 1317: 1260: 1252: 912: 774: 770: 168: 158: 8530: 8567: 7025:

Tambets, K; Rootsi, S; Kivisild, T; et al. (April 2004).

6023:"Mitochondrial DNA and Y-Chromosome Variation in the Caucasus" 3748: 3178:

13 (North Europe), 18 (Centre Europe), 21 (South Europe), 27 (

441:

into Europe of Anatolian farmers carrying Y-DNA G2a happened.

78: 36: 8514:

I2b2 Y-DNA found in Bronze Age skeletons of Lichtenstein Cave

288:

was reported as the oldest, being at least 30,800 years old.

8009:"Y-chromosome diversity in Sweden – A long-time perspective" 7429:"Y-chromosome diversity in Sweden – A long-time perspective" 6365:

Pericic M, Lauc LB, Klaric IM, et al. (October 2005).

4894:

have been reported to be the tallest in the world, with an

4839:

Haplogroup I2a2-M436 also occurs among approximately 1% of

4514:

There are also high frequencies of Haplogroup I* among the

9139:

International Society of Genetic Genealogy (ISOGG; 2015),

6839:

Forensic Science International: Genetics Supplement Series

6577:"Croatian genetic heritage: an updated Y-chromosome story" 3363:

48 (Serbia), 39 (Kosovo), 52 (Herzegovina and Montenegro)

9180:

Haplogroup LT (L298/P326) is also known as Haplogroup K1.

4648:, and I2a1a-M26 is the predominant type of I among them. 4455:

I2a2b L38/S154, L39/S155, L40/S156, L65.1/S159.1, L272.3

425:, Apulia, Italy were found to carry I-M170. So far, only 8160:

Celtic from the West Chapter 5: Irish Genetics and Celts

7468:

Rootsi S, Magri C, Kivisild T, et al. (July 2004).

5000:

Barać L, Pericić M, Klarić IM, et al. (July 2003).

4942:

men from Herzegovina were 185.2 centimeters on average.

989:

11 (West), 15 (North), 16 (East), 28 (Centre), 30 (East

5952:

Keyser-Tracqui, C; Crubézy, E; Ludes, B (August 2003).

4687:

The distribution of I2a1a-M26 also mirrors that of the

4573:, and subsequently spread throughout Europe during the 401:

culture. Later the haplogroup, along with two cases of

102: 52:

needs attention from an expert in Human Genetic History

4691:

cultures, which indicates a potential spread via the

6784:"Y Haplogroup Frequencies in the Flemish Populstion" 4309:

Haplogroup I2 L68/PF3781/S329, M438/P215/PF3853/S31

8609: 8454:

The Scandinavian yDNA Genealogical Project at FTDNA

208: 193: 183: 173: 163: 153: 139: 7169:MtDNA and Y-chromosome Variation in Kurdish Groups 6646: 6644: 6642: 4503:, at a rate of (3/21), as well as Turkey (8/741), 4318:I2a1a L158/PF4073/S433, L159.1/S169.1, M26/PF4056 2204:5 (North), 7 (Central), 9 (South and Sicily), 39 ( 8158:McEvoy and Bradley, Brian P and Daniel G (2010). 7165: 7163: 7011: 7009: 6640: 6638: 6636: 6634: 6632: 6630: 6628: 6626: 6624: 6622: 6467:Comptes rendus de l'Académie bulgare des Sciences 6240: 6238: 6236: 6234: 6232: 4824:or rather suggests a connection with the ancient 8412:Rescalled Haplogroup I Tree (K. Nordtvedt 2011). 6404: 6402: 4667:, southern and western France, and parts of the 497: – the ancestor of both haplogroups IJ and 7723: 7721: 5204:"ОБЗОР ДАННЫХ ИСКОПАЕМОЙ ДНК: ГАПЛОКАРТЫ G И I" 2954:) 30 (West), 42 (East, South), 35 (North), 33 ( 9252:(Access date of these pages: 9 December 2017) 7518:"Swedish Haplogroup Database (Stats haplopie)" 6360: 6358: 6356: 5119:The Genographic Project, National Geographic, 8542: 7153: 7151: 6659:Y-chromosomal variation in the Czech Republic 6335: 6333: 6222: 6220: 6218: 6216: 6001: 5999: 5997: 5834: 5832: 8: 8471:Study of Y-Haplogroup I and Modal Haplotypes 6279: 6277: 6275: 4577:when Germanic tribes migrated from southern 332: Solutrean and Proto-Solutrean Cultures 56:Nomenclature of haplogroup(s) and subclades. 9224:Haplogroup P (P295) is also klnown as K2b2. 8521:In Search of the Origin of I-L38 (aka I2b2) 8364:Phylogeography of Y-Chromosome Haplogroup I 7896:"Population genomics of Bronze Age Eurasia" 4922:male average height was 180.2 cm, the 481:as a long-standing corridor to Europe from 386:about 40,000 years ago. The TMRCA (time to 8549: 8535: 8527: 7834:Cristofaro J, et al. (October 2013). 7597:"Migration waves to the Baltic Sea region" 7073:A Y Chromosome Census of the British Isles 4173:, with a moderate distribution throughout 519: 417:The five known cases of Haplogroup I from 269:. This may indicate that IJ originated in 145: 8459:The Finland Genealogical Project at FTDNA 8358:Y-DNA Haplogroup I-M170 and Its Subclades 8317: 8276: 8219: 8209: 8056: 8054: 8052: 8024: 7975: 7869: 7859: 7810: 7745: 7612: 7493: 7444: 7268: 7258: 7050: 6850: 6723: 6670:https://doi.org/10.1038/s41431-019-0496-0 6602: 6592: 6537: 6527: 6463:"Y-Chromosomal Haplogroups in Bulgarians" 6437: 6382: 6196: 6186: 6137: 6119: 5977: 5914: 5679: 5661: 5571: 5553: 5480: 5430: 5373: 5363: 5311: 5259: 5178: 5094: 5084: 5020: 4875: 4869: 125:Learn how and when to remove this message 9162:Haplogroup A1 is also known as A1'2'3'4. 8162:. Oxbow Books, Oxford, UK. p. 117. 7342:Forensic Science International: Genetics 7303:Forensic Science International. Genetics 6835:"Phylogeography of French male lineages" 5333: 5331: 4779:in northwestern France; the province of 313: 302: 9088: 8481:Example haplotypes from I1* "y cluster" 8352:Phylogenetic tree and distribution maps 8145:National Academy of Sciences of Ukraine 5867:"The genetic history of Ice Age Europe" 5399:"The genetic history of Ice Age Europe" 5228:"The genetic history of Ice Age Europe" 5139: 4926:men were on average 181.4 cm, the 4902:, 184 cm (6 ft 0 in) in 4783:in southeastern France; the regions of 3470:32 (Ostergotaland & Jonkoping) 50 ( 6959:: CS1 maint: archived copy as title ( 6952: 233:, which itself is a derivative of the 136: 62:may be able to help recruit an expert. 4859:Nucleotide change (rs2319818): G to A 7: 9075:Y-DNA haplogroups of historic people 9050: 9045: 9036: 9034: 9029: 9027: 9022: 9017: 9012: 9006: 8999: 8989: 8987: 8977: 8969: 8957: 8955: 8946: 8938: 8896: 8889: 8883: 8881: 8875: 8869: 8867: 8861: 8855: 8843: 8833: 8827: 8821: 8812: 8807: 8798: 8793: 8784: 8779: 8743: 8729: 8612: 7157:Y chromosomes in Iranians and Tajiks 6773:Migration Eaves to the Baltic Region 5281: 5279: 5221: 5219: 5217: 5127:Y-DNA Haplogroup I and its Subclades 4362:I2a2a1a1a L126/S165, L137/S166, L369 437:Europe, until circa 6,000 BCE, when 8717: 8657: 8640: 6285:"Where did European men come from?" 4855:The technical details of U179 are: 1571:36 (Swedes from Ostrobothnia), 15 ( 8013:European Journal of Human Genetics 7783:American Journal of Human Genetics 7433:European Journal of Human Genetics 7399:ANALIZA Y-DNK HAPLOTIPOV SLOVENCEV 6418:European Journal of Human Genetics 5159:American Journal of Human Genetics 4957:Human Y-chromosome DNA haplogroups 25: 9144:. (Access date: 1 February 2015.) 8476:The Y Chromosome Consortium (YCC) 6575:D. Primorac; et al. (2022). 5397:Fu, Qiaomei; et al. (2016). 5226:Fu, Qiaomei; et al. (2016). 5202:Львович, Рожанский Игорь (2021). 3975:), 25 (Ukrainians from Rashkovo) 448:(EEFs), I-M170 is outnumbered by 60:WikiProject Human Genetic History 27:Human Y-chromosome DNA haplogroup 8572: 8104:10.1111/j.1529-8817.2005.00190.x 7614:10.1111/j.1469-1809.2007.00429.x 7566:10.1111/j.1469-1809.2005.00251.x 6708:10.1111/j.1469-1809.2009.00538.x 6042:10.1046/j.1529-8817.2004.00092.x 4820:in Turkey may be related to the 2879:29 (Moldovans), 25 (Ukrainians) 444:Due to the arrival of so-called 229:haplogroup. It is a subgroup of 83: 41: 9197:, the sibling of Haplogroup LT. 7708:"ISOGG 2017 Y-DNA Haplogroup I" 5840:"Palaeolithic DNA from Eurasia" 4470:I2c L596/PF6907/S292, L597/S333 4239:I1a2a1 S337/Z60, S439/Z61, Z62 3116:) 37 (Taktakoz), 11 (Slovakia) 5781:Rethinking the Human Evolution 4154:Middle East, Caucasus, Europe. 463:The earliest documentation of 1: 8374:Frequency and Variance of I1b 8306:Economics & Human Biology 6991:10.1016/S0531-5131(03)01635-2 6979:International Congress Series 5815:10.1126/science.290.5494.1155 5629:Seguin-Orlando et al. (2014)「 4799:and the area around Russia's 4077:3 (Tajiks) 3 (East Persians) 3453:), 4 (Gaalien), 7 (Mesereia) 517:Frequencies of Haplogroup I: 367:(south west Russia) C1b, and 8559:Y-chromosome DNA haplogroups 8211:10.1371/journal.pone.0034288 7861:10.1371/journal.pone.0076748 7354:10.1016/j.fsigen.2022.102767 7315:10.1016/j.fsigen.2017.07.013 7260:10.1371/journal.pone.0041803 6852:10.1016/j.fsigss.2009.09.026 6755:s-media-cache-ak0.pinimg.com 6529:10.1371/journal.pone.0056779 6188:10.1371/journal.pone.0034288 6121:10.1371/journal.pone.0034288 5365:10.1371/journal.pone.0041252 4934:men were 180.6 cm, the 4930:men were 183.8 cm, the 4865:Total size (base pairs): 220 4507:in the Caucasus (2/138) and 1015:- 43 (Vichin), 12 (Avtyuki) 359:(modern west Siberia) K2a*, 338: Epi-Gravettian Culture 8557:Phylogenetic tree of human 5704:"Y-SNP calls for Krems WA3" 4585:to other places in Europe. 388:most recent common ancestor 54:. The specific problem is: 9310: 9141:Y-DNA Haplogroup Tree 2015 9043: 9010: 8967: 8936: 8927: 8919: 8912: 8905: 8898: 8853: 8819: 8805: 8791: 8777: 8761: 8745: 8614: 8491:Haplo-I Subclade Predictor 8449:I2b2 L38+ project at FTDNA 8395:(now considered I2a-P37.2) 8249:Royal Society Open Science 6812:10.1016/j.gene.2006.03.004 5663:10.1038/s42003-020-01372-8 5555:10.1038/s41598-020-78841-x 5505:"Publications Detail View" 5473:10.1038/s41586-023-05726-0 5121:Atlas of the Human Journey 4851:Specifications of mutation 4611: 4551: 4165:Typical of populations of 1162:Begona Martinez-Cruz 2012 29: 9064: 8842: 8835: 8769: 8752: 8736: 8731: 8724: 8719: 8710: 8705: 8703: 8696: 8691: 8689: 8682: 8675: 8673: 8666: 8659: 8649: 8642: 8632: 8625: 8623: 8607: 8581:This article needs to be 8565: 8408:(now considered I2b-M223) 8376:(now considered I2a2-M26) 8319:10.1016/j.ehb.2014.07.002 7977:10.1016/j.cub.2009.09.017 7734:Journal of Human Genetics 7670:10.1007/s00439-003-1031-4 6892:10.1007/s00439-005-1333-9 4862:Position (base pair): 275 378:Haplogroup IJ was in the 144: 8519:Haplogroup I-L38 (I2b2) 8147:. pp. 219–226, 302. 7554:Annals of Human Genetics 6696:Annals of Human Genetics 6581:Croatian Medical Journal 6562:"Bulgarian_Y_Table.xlsx" 6030:Annals of Human Genetics 4938:were 180.9 cm, and 4847:from Afghanistan at 3%. 456:European remains and by 174:Possible place of origin 97:may need to be rewritten 9294:Human Y-DNA haplogroups 9189:Between 2002 and 2008, 8382:(now considered I-M253) 8026:10.1038/sj.ejhg.5201651 7446:10.1038/sj.ejhg.5201651 6966:(subscription required) 6594:10.3325/cmj.2022.63.273 5750:10.1126/science.1172873 5022:10.1038/sj.ejhg.5200992 4834:Nicomedes I of Bithynia 4353:I2a2a1 CTS616, CTS9183 3551:), 52 (South Norrland) 3513:41 (South), 26 (North) 3121:Vago Zalan Andrea 2008 1930:Vago Zalan Andrea 2008 1870:12 (North), 24 (South) 154:Possible time of origin 8503:Spread of Haplogroup I 6255:"Armenian DNA Project" 5650:Communications Biology 4876:cagctcctcttttcaactctca 4709: 4414:I2a2a1c1b1a1a S434/Z79 4326:I2a1b L178/S328, M423 4279:I1a2b S296/Z138, Z139 1089:Bosnia and Herzegovina 1058:Bosnia and Herzegovina 1027:Bosnia and Herzegovina 446:Early European Farmers 340: 322:refuges, 20,000 years 311: 282:Dolní Věstonice (DV14) 8133:O.M. Utevska (2017). 6430:10.1038/ejhg.2008.249 6384:10.1093/molbev/msi185 4967:Haplogroup I2 (Y-DNA) 4962:Haplogroup I1 (Y-DNA) 4870:aaggggatatgacgactgatt 4713:Haplogroup I2a1b-M423 4706: 4427:I2a2a1c2 L623, L147.4 4312:I2a L460/PF3647/S238 3959:from Karasahani) 24 ( 993:), 34 (West Polesie) 535:hg I (Subpopulation) 317: 306: 251:Southeastern European 8444:I2b project at FTDNA 8439:I2a project at FTDNA 8434:I2* Project at FTDNA 8061:Rootsi; et al. 4982:Proto-Indo-Europeans 4972:Late Glacial Maximum 4910:mostly populated by 4805:Republic of Mordovia 4737:Haplogroup I2a2-M436 4735:The distribution of 4642:Haplogroup I2a1a-M26 4467:I2b L415, L416, L417 4378:I2a2a1b2 L699, L703 3909:in Andon Poci), 42 ( 1981:22 (South Iran), 5 ( 538:Sampled individuals 392:Last Glacial Maximum 32:Haplogroup I (mtDNA) 9070:Y-DNA by population 8985: 8508:National Geographic 8429:I1 Project at FTDNA 8269:10.1098/rsos.161054 8261:2017RSOS....461054G 8202:2012PLoSO...734288H 7920:10.1038/nature14507 7912:2015Natur.522..167A 7852:2013PLoSO...876748D 7747:10.1038/jhg.2009.94 7251:2012PLoSO...741803M 6520:2013PLoSO...856779K 6179:2012PLoSO...734288H 6112:2012PLoSO...734288H 5891:10.1038/nature17993 5883:2016Natur.534..200F 5807:2000Sci...290.1155S 5742:2009Sci...325..710C 5546:2020NatSR..1021931M 5423:10.1038/nature17993 5415:2016Natur.534..200F 5356:2012PLoSO...741252G 5252:10.1038/nature17993 5244:2016Natur.534..200F 5208:Исторический формат 4896:average male height 4689:Atlantic Bronze Age 4438:I2a2a1d1a L812/S391 4391:I2a2a1c1 L801/S390 4372:I2a2a1b L701, L702 4242:I1a2a1a Z140, Z141 4190:I1a1 CTS6364/Z2336 4068:Nasidze Ivan. 2004 3806:Kushniarevich 2013 3612:2 (West), 3 (East) 3496:26 (North Sweden), 3148:Martinez-Cruz 2012 2937:Di Cristofaro 2013 2742:Kushniarevich 2015 2631:Di Cristofaro 2013 2305:Cappadocia, Abruzzo 2007:1 (West), 1 (East) 1995:Di Cristofaro 2013 1144:Karachanak 2009–13 999:Kushniarevich 2013 735:Di Cristofaro 2013 475:Southeastern Europe 9110:10.1002/humu.22468 8836: 8617:Y-chromosomal Adam 8496:2022-04-02 at the 8424:I Project at FTDNA 8404:2008-08-16 at the 8391:2015-05-01 at the 8184:Pierre A. (2012). 5783:(2007), pp. 33–42. 5534:Scientific Reports 5304:10.1101/gr.7172008 5210:(4 (28)): 125–140. 5063:. BioRxiv, 685404. 5009:Eur. J. Hum. Genet 4725:Bosnia-Herzegovina 4719:, most notably in 4710: 4619:Haplogroup I2-M438 4559:Haplogroup I1-M253 4411:I2a2a1c1b1a1 Z190 4408:I2a2a1c1b1a L1198 4402:I2a2a1c1b CTS6433 4394:I2a2a1c1a CTS1977 4329:I2a1b1 L161.1/S185 4321:I2a1a1 L160/PF4013 4213:I1a1b3a L258/S335 3387:Petrejcikova 2013 3108:17 (Hungary), 10 ( 1726:Nasidze Ivan 2004 1633:Nord Pas de Calais 1370:Nasidze Ivan 2004 958:Nasidze Ivan 2004 645:Nasidze Ivan 2004 577:Nasidze Ivan 2004 477:. The role of the 460:in later remains. 341: 312: 209:Defining mutations 9281: 9280: 9243:, 2017, "K-M2335" 9241:YFull YTree v5.08 9191:Haplogroup T-M184 9059: 9058: 9004: 8994: 8984: 8975: 8963: 8952: 8944: 8932: 8924: 8917: 8910: 8903: 8848: 8767: 8759: 8750: 8680: 8664: 8647: 8630: 8602: 8601: 8169:978-1-84217-410-4 7970:(20): 1758–1762. 7906:(7555): 167–172. 7474:Am. J. Hum. Genet 7031:Am. J. Hum. Genet 6036:(Pt 3): 205–221. 5958:Am. J. Hum. Genet 5877:(7606): 200–205. 5509:fgga.univie.ac.at 5467:(7950): 117–126. 5073:Am. J. Hum. Genet 4614:Haplogroup I-M438 4571:Nordic Bronze Age 4554:Haplogroup I-M253 4332:I2a1b2 L621/S392 4127: 4126: 3717:Eastern Anatolia 2492:Kosovar Albanians 2350:Brisighelli 2012 1860:Di Giacommo 2003 1581:Lappalainen 2006 1540:Lappalainen 2008 1065:Herzegovina- 71 ( 493:The existence of 419:Upper Paleolithic 247:Northern European 216: 215: 167:~27,500 Years BP 157:~42,900 Years BP 140:Haplogroup I-M170 135: 134: 127: 107:lead layout guide 77: 76: 16:(Redirected from 9301: 9271: 9268: 9262: 9259: 9253: 9231: 9225: 9222: 9216: 9213: 9207: 9204: 9198: 9187: 9181: 9178: 9172: 9169: 9163: 9160: 9154: 9151: 9145: 9136: 9130: 9129: 9093: 9000: 8990: 8978: 8970: 8958: 8948: 8939: 8928: 8920: 8913: 8906: 8899: 8844: 8763: 8754: 8746: 8676: 8660: 8643: 8626: 8610: 8597: 8594: 8588: 8576: 8575: 8568: 8551: 8544: 8537: 8528: 8340: 8339: 8321: 8297: 8291: 8290: 8280: 8240: 8234: 8233: 8223: 8213: 8180: 8174: 8173: 8155: 8149: 8148: 8130: 8124: 8123: 8098:(Pt 6): 757–63. 8083: 8077: 8076: 8074: 8068:. Archived from 8067: 8058: 8047: 8046: 8028: 8004: 7998: 7997: 7979: 7954: 7948: 7947: 7890: 7884: 7883: 7873: 7863: 7831: 7825: 7824: 7814: 7774: 7768: 7767: 7749: 7725: 7716: 7715: 7704: 7698: 7697: 7652: 7646: 7641: 7635: 7634: 7616: 7607:(Pt 3): 337–48. 7592: 7586: 7585: 7560:(Pt 4): 459–87. 7548: 7542: 7539: 7533: 7532: 7530: 7529: 7520:. Archived from 7514: 7508: 7507: 7497: 7465: 7459: 7458: 7448: 7424: 7418: 7415: 7409: 7406: 7400: 7397: 7391: 7388: 7382: 7381: 7333: 7327: 7326: 7298: 7292: 7289: 7283: 7282: 7272: 7262: 7230: 7224: 7221: 7215: 7212: 7206: 7203: 7197: 7194: 7188: 7185: 7179: 7176: 7170: 7167: 7158: 7155: 7146: 7143: 7137: 7134: 7128: 7125: 7119: 7116: 7110: 7107: 7101: 7098: 7092: 7089: 7083: 7080: 7074: 7071: 7065: 7064: 7054: 7022: 7016: 7013: 7004: 7001: 6995: 6994: 6974: 6968: 6967: 6964: 6958: 6950: 6948: 6947: 6941: 6935:. Archived from 6934: 6926: 6920: 6919: 6871: 6865: 6864: 6854: 6830: 6824: 6823: 6794: 6788: 6787: 6780: 6774: 6771: 6765: 6764: 6762: 6761: 6752: 6744: 6738: 6737: 6727: 6687: 6681: 6678: 6672: 6666: 6660: 6657: 6651: 6648: 6617: 6616: 6606: 6596: 6572: 6566: 6565: 6558: 6552: 6551: 6541: 6531: 6499: 6493: 6492: 6487: 6458: 6452: 6451: 6441: 6415: 6406: 6397: 6396: 6386: 6362: 6351: 6346: 6340: 6337: 6328: 6327: 6325: 6324: 6315:. Archived from 6309: 6303: 6302: 6300: 6299: 6289: 6281: 6270: 6269: 6267: 6266: 6257:. Archived from 6251: 6245: 6242: 6227: 6224: 6211: 6210: 6200: 6190: 6158: 6152: 6151: 6141: 6123: 6091: 6085: 6082: 6076: 6075: 6073: 6072: 6066: 6060:. Archived from 6027: 6017: 6006: 6003: 5992: 5991: 5981: 5949: 5943: 5942: 5941:. February 2017. 5935: 5929: 5928: 5918: 5862: 5856: 5855: 5853: 5851: 5842:. Archived from 5836: 5827: 5826: 5801:(5494): 1155–9. 5790: 5784: 5776: 5770: 5769: 5725: 5719: 5718: 5716: 5715: 5700: 5694: 5693: 5683: 5665: 5640: 5634: 5627: 5621: 5620: 5592: 5586: 5585: 5575: 5557: 5525: 5519: 5518: 5516: 5515: 5501: 5495: 5494: 5484: 5451: 5445: 5444: 5434: 5394: 5388: 5387: 5377: 5367: 5335: 5326: 5325: 5315: 5283: 5274: 5273: 5263: 5223: 5212: 5211: 5199: 5193: 5192: 5182: 5149: 5116: 5098: 5088: 5056: 5054: 5053: 5047: 5041:. Archived from 5024: 5006: 4877: 4874:Reverse 5′→ 3′: 4871: 4868:Forward 5′→ 3′: 4810:Germanic peoples 4653:Balearic Islands 4575:Migration Period 4335:I2a1b2a1a L147.2 4226:I1a1b5 L813/Z719 4223:I1a1b4 L300/S241 4171:Northwest Europe 4082:Malyarchuk 2013 4022:Lappalainen2008 3713:Central Anatolia 3369:Mihajlovic 2022 3188:Balanovsky 2008 2540:Malyarchuk 2013 2469:Sergeevich 2007 2287:Di Giacomo 2003 1641:Ramos-Luis 2009 1593:16 (South), 24 ( 1052:Marjanovic 2006 1021:Sergeevich 2015 794:21.82% (12/55) ( 622:Sergeevich 2007 559:Sergeevich 2007 520: 363:(Romania) K2a*, 337: 331: 227:Y-chromosome DNA 149: 137: 130: 123: 119: 116: 110: 103:improve the lead 87: 86: 79: 72: 69: 63: 45: 44: 37: 21: 9309: 9308: 9304: 9303: 9302: 9300: 9299: 9298: 9284: 9283: 9282: 9277: 9276: 9275: 9274: 9269: 9265: 9260: 9256: 9232: 9228: 9223: 9219: 9214: 9210: 9205: 9201: 9188: 9184: 9179: 9175: 9170: 9166: 9161: 9157: 9152: 9148: 9137: 9133: 9095: 9094: 9090: 9085: 9079: 9060: 8603: 8598: 8592: 8589: 8586: 8577: 8573: 8561: 8555: 8498:Wayback Machine 8467: 8420: 8406:Wayback Machine 8393:Wayback Machine 8354: 8349: 8344: 8343: 8299: 8298: 8294: 8242: 8241: 8237: 8182: 8181: 8177: 8170: 8157: 8156: 8152: 8132: 8131: 8127: 8092:Ann. Hum. Genet 8085: 8084: 8080: 8072: 8065: 8060: 8059: 8050: 8006: 8005: 8001: 7964:Current Biology 7956: 7955: 7951: 7892: 7891: 7887: 7833: 7832: 7828: 7776: 7775: 7771: 7740:(12): 689–694. 7727: 7726: 7719: 7706: 7705: 7701: 7654: 7653: 7649: 7642: 7638: 7601:Ann. Hum. Genet 7594: 7593: 7589: 7550: 7549: 7545: 7540: 7536: 7527: 7525: 7516: 7515: 7511: 7467: 7466: 7462: 7426: 7425: 7421: 7416: 7412: 7407: 7403: 7398: 7394: 7389: 7385: 7335: 7334: 7330: 7300: 7299: 7295: 7290: 7286: 7232: 7231: 7227: 7222: 7218: 7213: 7209: 7204: 7200: 7195: 7191: 7186: 7182: 7177: 7173: 7168: 7161: 7156: 7149: 7144: 7140: 7135: 7131: 7126: 7122: 7117: 7113: 7108: 7104: 7099: 7095: 7090: 7086: 7081: 7077: 7072: 7068: 7024: 7023: 7019: 7014: 7007: 7002: 6998: 6976: 6975: 6971: 6965: 6951: 6945: 6943: 6939: 6932: 6930:"Archived copy" 6928: 6927: 6923: 6873: 6872: 6868: 6832: 6831: 6827: 6796: 6795: 6791: 6782: 6781: 6777: 6772: 6768: 6759: 6757: 6750: 6746: 6745: 6741: 6689: 6688: 6684: 6679: 6675: 6667: 6663: 6658: 6654: 6649: 6620: 6574: 6573: 6569: 6560: 6559: 6555: 6501: 6500: 6496: 6485: 6460: 6459: 6455: 6413: 6408: 6407: 6400: 6377:(10): 1964–75. 6371:Mol. Biol. Evol 6364: 6363: 6354: 6347: 6343: 6338: 6331: 6322: 6320: 6311: 6310: 6306: 6297: 6295: 6287: 6283: 6282: 6273: 6264: 6262: 6253: 6252: 6248: 6243: 6230: 6225: 6214: 6160: 6159: 6155: 6093: 6092: 6088: 6084:Yunusbayev 2011 6083: 6079: 6070: 6068: 6064: 6025: 6019: 6018: 6009: 6004: 5995: 5951: 5950: 5946: 5937: 5936: 5932: 5864: 5863: 5859: 5849: 5847: 5838: 5837: 5830: 5792: 5791: 5787: 5777: 5773: 5736:(5941): 710–4. 5727: 5726: 5722: 5713: 5711: 5702: 5701: 5697: 5642: 5641: 5637: 5628: 5624: 5594: 5593: 5589: 5527: 5526: 5522: 5513: 5511: 5503: 5502: 5498: 5453: 5452: 5448: 5409:(7606): 200–5. 5396: 5395: 5391: 5338:Grugni (2012). 5337: 5336: 5329: 5292:Genome Research 5285: 5284: 5277: 5238:(7606): 200–5. 5225: 5224: 5215: 5201: 5200: 5196: 5151: 5150: 5141: 5136: 5131: 5066: 5051: 5049: 5045: 5004: 4999: 4995: 4948: 4884: 4853: 4822:Varangian Guard 4745:founder effects 4733: 4717:Western Balkans 4701: 4639: 4616: 4610: 4556: 4550: 4490:subclade I-M170 4486: 4435:I2a2a1d1 Z2054 4405:I2a2a1c1b1 Z78 4365:I2a2a1a1b L1193 4359:I2a2a1a1 L1195 4342:I2a1c L233/S183 4245:I1a2a1a1 Z2535 4236:I1a2a S246/Z59 4201:I1a1b L22/S142 4132: 3999:Eastern Finland 3995:Western Finland 3798:Ivano-Frankivsk 3725:Cinnioglu 2003 3402:Spodnjeposavska 2849:Battaglia 2008 1804:Battaglia 2008 1424:Van Doorn 2008 1176:Bulgarian Turks 1109:Battaglia 2008 1073:), Bosnia- 54 ( 804:Battaglia 2008 714:, 2.1% (3/142) 515: 507:Iranian Plateau 339: 335: 333: 329: 327: 301: 271:South West Asia 164:Coalescence age 131: 120: 114: 111: 100: 88: 84: 73: 67: 64: 58: 46: 42: 35: 28: 23: 22: 15: 12: 11: 5: 9307: 9305: 9297: 9296: 9286: 9285: 9279: 9278: 9273: 9272: 9263: 9254: 9226: 9217: 9208: 9199: 9182: 9173: 9164: 9155: 9146: 9131: 9098:Human Mutation 9087: 9086: 9081: 9080: 9078: 9077: 9072: 9066: 9065: 9062: 9061: 9057: 9056: 9054: 9049: 9044: 9041: 9040: 9035: 9033: 9028: 9026: 9021: 9016: 9011: 9008: 9007: 9005: 8998: 8996: 8988: 8986: 8976: 8968: 8965: 8964: 8956: 8954: 8945: 8937: 8934: 8933: 8926: 8918: 8911: 8904: 8897: 8895: 8888: 8882: 8880: 8874: 8868: 8866: 8860: 8854: 8851: 8850: 8841: 8834: 8832: 8826: 8820: 8817: 8816: 8811: 8806: 8803: 8802: 8797: 8792: 8789: 8788: 8783: 8778: 8775: 8774: 8768: 8760: 8751: 8744: 8741: 8740: 8735: 8730: 8728: 8723: 8718: 8715: 8714: 8709: 8704: 8701: 8700: 8695: 8690: 8687: 8686: 8681: 8674: 8671: 8670: 8665: 8658: 8655: 8654: 8648: 8641: 8638: 8637: 8631: 8624: 8621: 8620: 8613: 8608: 8605: 8604: 8600: 8599: 8580: 8578: 8571: 8566: 8563: 8562: 8556: 8554: 8553: 8546: 8539: 8531: 8525: 8524: 8516: 8511: 8500: 8488: 8483: 8478: 8473: 8466: 8463: 8462: 8461: 8456: 8451: 8446: 8441: 8436: 8431: 8426: 8419: 8416: 8415: 8414: 8409: 8396: 8383: 8377: 8371: 8366: 8361: 8353: 8350: 8348: 8347:External links 8345: 8342: 8341: 8292: 8235: 8175: 8168: 8150: 8125: 8078: 8075:on 2007-03-03. 8048: 8019:(8): 963–970. 7999: 7949: 7885: 7846:(10): e76748. 7826: 7795:10.1086/422196 7789:(1): 128–137. 7769: 7717: 7699: 7664:(2): 127–148. 7658:Human Genetics 7647: 7636: 7587: 7543: 7534: 7509: 7486:10.1086/422196 7460: 7439:(8): 963–970. 7419: 7410: 7401: 7392: 7383: 7328: 7293: 7284: 7225: 7216: 7207: 7198: 7189: 7180: 7171: 7159: 7147: 7138: 7129: 7120: 7111: 7102: 7093: 7084: 7075: 7066: 7043:10.1086/383203 7017: 7005: 6996: 6969: 6921: 6886:(5): 428–443. 6880:Human Genetics 6866: 6845:(1): 439–441. 6825: 6806:(2): 207–215. 6789: 6775: 6766: 6739: 6702:(6): 568–581. 6682: 6673: 6661: 6652: 6618: 6587:(3): 273–286. 6567: 6553: 6494: 6473:(3): 393–400. 6453: 6398: 6352: 6341: 6329: 6304: 6271: 6246: 6228: 6212: 6153: 6086: 6077: 6007: 5993: 5970:10.1086/377005 5944: 5930: 5899:10211.3/198594 5857: 5828: 5785: 5771: 5720: 5695: 5635: 5622: 5609:10.1101/685404 5587: 5520: 5496: 5446: 5389: 5327: 5275: 5213: 5194: 5171:10.1086/422196 5165:(1): 128–137. 5138: 5137: 5135: 5132: 5130: 5129: 5123: 5117: 5086:10.1086/422196 5079:(1): 128–137. 5064: 5057: 4996: 4994: 4991: 4990: 4989: 4984: 4979: 4974: 4969: 4964: 4959: 4954: 4947: 4944: 4916:haplogroups I1 4883: 4880: 4879: 4878: 4872: 4866: 4863: 4860: 4852: 4849: 4795:in Italy; and 4732: 4729: 4700: 4697: 4661:Basque Country 4638: 4635: 4612:Main article: 4609: 4606: 4552:Main article: 4549: 4546: 4488:The composite 4485: 4482: 4476: 4475: 4474: 4473: 4472: 4471: 4468: 4465: 4464: 4463: 4462: 4461: 4460: 4459: 4453: 4452: 4451: 4448: 4447: 4446: 4445: 4444: 4443:I2a2a1d2 L1230 4441: 4440: 4439: 4432:I2a2a1d L1229 4430: 4429: 4428: 4425: 4424: 4423: 4422: 4421: 4420: 4419: 4418: 4417: 4416: 4415: 4400: 4399: 4398: 4397:I2a2a1c1a1 P95 4386: 4385: 4384: 4383: 4382: 4381:I2a2a1b2a L704 4376: 4370: 4369: 4368: 4367: 4366: 4363: 4345: 4344: 4343: 4340: 4339: 4338: 4337: 4336: 4330: 4324: 4323: 4322: 4302: 4301: 4300: 4297: 4296: 4295: 4294: 4293: 4289:I1a3 S243/Z63 4287: 4286: 4285: 4284: 4283: 4277: 4276: 4275: 4272: 4271: 4270: 4269: 4268: 4264:I1a2a1d L1248 4262: 4259: 4256: 4255: 4254: 4253:I1a2a1a2 F2642 4251: 4250: 4249: 4248:I1a2a1a1a L338 4233:I1a2 S244/Z58 4231: 4230: 4229: 4228: 4227: 4224: 4221: 4220: 4219: 4218: 4217: 4208: 4205: 4199: 4198: 4197: 4187:I1a DF29/S438 4175:Eastern Europe 4131: 4128: 4125: 4124: 4122: 4120: 4089: 4087: 4084: 4083: 4080: 4078: 4075: 4073: 4070: 4069: 4066: 4064: 4029: 4027: 4024: 4023: 4020: 4018: 3987: 3985: 3982: 3981: 3978: 3976: 3933: 3931: 3928: 3927: 3924: 3922: 3871: 3869: 3866: 3865: 3862: 3859: 3852: 3850: 3844: 3843: 3842:El-Sibai 2009 3840: 3837: 3835: 3832: 3826: 3825: 3822: 3819: 3817: 3814: 3808: 3807: 3804: 3801: 3790: 3787: 3781: 3780: 3777: 3774: 3772: 3769: 3763: 3762: 3761:El-Sibai 2009 3759: 3756: 3754: 3751: 3745: 3744: 3741: 3738: 3736: 3733: 3727: 3726: 3723: 3720: 3707:), 7 (Western 3697: 3694: 3688: 3687: 3685: 3682: 3680: 3677: 3671: 3670: 3669:El-Sibai 2009 3667: 3665: 3663: 3660: 3654: 3653: 3651: 3648: 3645: 3643: 3637: 3636: 3635:El Sibai 2009 3633: 3630: 3628: 3625: 3619: 3618: 3616: 3613: 3610: 3608: 3602: 3601: 3599: 3597: 3586: 3583: 3577: 3576: 3573: 3570: 3568: 3565: 3559: 3558: 3555: 3552: 3529: 3526: 3520: 3519: 3516: 3514: 3511: 3509: 3503: 3502: 3499: 3497: 3494: 3492: 3486: 3485: 3482: 3479: 3468: 3465: 3459: 3458: 3456: 3454: 3447: 3445: 3439: 3438: 3435: 3432: 3421: 3418: 3412: 3411: 3408: 3405: 3398: 3395: 3389: 3388: 3385: 3382: 3380: 3377: 3371: 3370: 3367: 3364: 3361: 3359: 3353: 3352: 3351:Zgonjanin 209 3349: 3346: 3337: 3334: 3328: 3327: 3324: 3317: 3315: 3309: 3308: 3305: 3303: 3300:Scottish Isles 3296: 3293: 3287: 3286: 3284: 3281: 3279: 3276: 3270: 3269: 3266: 3264: 3262: 3259: 3253: 3252: 3249: 3247: 3196: 3194: 3190: 3189: 3186: 3183: 3176: 3174: 3168: 3167: 3164: 3161: 3159: 3156: 3150: 3149: 3146: 3143: 3132: 3129: 3123: 3122: 3119: 3117: 3106: 3104: 3098: 3097: 3096:El-Sibai 2009 3094: 3091: 3089: 3086: 3080: 3079: 3076: 3073: 3058: 3055: 3049: 3048: 3045: 3042: 3040: 3037: 3031: 3030: 3027: 3024: 3022: 3019: 3013: 3012: 3009: 3006: 2991: 2988: 2982: 2981: 2979: 2976: 2974: 2971: 2965: 2964: 2961: 2959: 2948: 2945: 2939: 2938: 2935: 2932: 2930: 2927: 2921: 2920: 2918: 2915: 2913: 2910: 2904: 2903: 2902:El-Sibai 2009 2900: 2897: 2895: 2892: 2886: 2885: 2882: 2880: 2877: 2875: 2869: 2868: 2867:El-Sibai 2009 2865: 2862: 2860: 2857: 2851: 2850: 2847: 2844: 2837: 2835: 2829: 2828: 2825: 2822: 2811: 2808: 2802: 2801: 2798: 2795: 2788: 2786: 2780: 2779: 2776: 2773: 2770: 2767: 2761: 2760: 2758: 2755: 2753: 2750: 2744: 2743: 2740: 2738: 2736: 2733: 2727: 2726: 2724: 2721: 2719: 2716: 2710: 2709: 2706: 2703: 2701: 2698: 2692: 2691: 2689: 2686: 2675: 2672: 2666: 2665: 2663: 2661: 2660:3 (Southwest) 2658: 2655: 2649: 2648: 2646: 2644: 2642: 2639: 2633: 2632: 2629: 2627: 2616: 2614: 2608: 2607: 2606:El-Sibai 2009 2604: 2601: 2599: 2596: 2590: 2589: 2586: 2583: 2572: 2570: 2564: 2563: 2560: 2557: 2550: 2548: 2542: 2541: 2538: 2535: 2534:4 (West Iran) 2532: 2530: 2524: 2523: 2520: 2517: 2515: 2512: 2506: 2505: 2502: 2499: 2497: 2494: 2488: 2487: 2485: 2482: 2480: 2477: 2471: 2470: 2467: 2464: 2462: 2459: 2455: 2454: 2452: 2449: 2447: 2444: 2437: 2436: 2433: 2430: 2419: 2417: 2411: 2410: 2409:El-Sibai 2009 2407: 2404: 2402: 2399: 2393: 2392: 2389: 2387: 2380: 2378: 2372: 2371: 2369: 2367: 2360: 2358: 2352: 2351: 2348: 2345: 2326: 2324: 2318: 2317: 2314: 2312: 2297: 2295: 2289: 2288: 2285: 2282: 2265:, Garfagnana, 2255: 2252: 2246: 2245: 2244:Boattini 2013 2242: 2239: 2224: 2221: 2215: 2214: 2211: 2209: 2202: 2200: 2194: 2193: 2190: 2188: 2181: 2179: 2173: 2172: 2169: 2166: 2164: 2161: 2155: 2154: 2151: 2148: 2146: 2143: 2137: 2136: 2135:El-Sibai 2009 2133: 2130: 2128: 2125: 2119: 2118: 2115: 2112: 2110: 2107: 2101: 2100: 2097: 2094: 2059: 2056: 2050: 2049: 2048:El-Sibai 2009 2046: 2043: 2041: 2038: 2032: 2031: 2028: 2025: 2023: 2020: 2014: 2013: 2011: 2008: 2005: 2003: 1997: 1996: 1993: 1990: 1979: 1976: 1970: 1969: 1967: 1964: 1962: 1959: 1953: 1952: 1950: 1947: 1940: 1938: 1932: 1931: 1928: 1925: 1923: 1920: 1914: 1913: 1910: 1907: 1905: 1902: 1896: 1895: 1892: 1889: 1887: 1884: 1878: 1877: 1874: 1871: 1868: 1866: 1862: 1861: 1858: 1855: 1812: 1810: 1806: 1805: 1802: 1799: 1788: 1786: 1782: 1781: 1778: 1775: 1768: 1765: 1759: 1758: 1755: 1752: 1737: 1734: 1728: 1727: 1724: 1721: 1719: 1716: 1710: 1709: 1706: 1703: 1701: 1698: 1692: 1691: 1688: 1685: 1683: 1680: 1674: 1673: 1670: 1667: 1652: 1649: 1643: 1642: 1639: 1636: 1621: 1618: 1612: 1611: 1608: 1606: 1591: 1589: 1583: 1582: 1579: 1576: 1569: 1566: 1560: 1559: 1557: 1554: 1552: 1549: 1542: 1541: 1538: 1535: 1533: 1530: 1524: 1523: 1520: 1517: 1506: 1503: 1497: 1496: 1493: 1490: 1488: 1485: 1479: 1478: 1475: 1472: 1470: 1467: 1461: 1460: 1458: 1455: 1453: 1450: 1444: 1443: 1442:El-Sibai 2009 1440: 1437: 1435: 1432: 1426: 1425: 1422: 1419: 1417: 1414: 1408: 1407: 1404: 1401: 1399: 1396: 1390: 1389: 1387: 1384: 1382: 1379: 1372: 1371: 1368: 1365: 1363: 1360: 1354: 1353: 1350: 1347: 1345: 1342: 1336: 1335: 1332: 1329: 1322:Hradec Králové 1306: 1303: 1297: 1296: 1295:El-Sibai 2009 1293: 1290: 1288: 1285: 1279: 1278: 1277:Primorac 2022 1275: 1272: 1249: 1246: 1240: 1239: 1236: 1233: 1231: 1228: 1222: 1221: 1218: 1215: 1213: 1210: 1204: 1203: 1200: 1197: 1195: 1192: 1186: 1185: 1184:Zaharova 2002 1182: 1179: 1172: 1170: 1164: 1163: 1160: 1157: 1155: 1152: 1146: 1145: 1142: 1139: 1120: 1117: 1111: 1110: 1107: 1104: 1103:), 36 (Serbs) 1093: 1091: 1085: 1084: 1081: 1078: 1063: 1060: 1054: 1053: 1050: 1047: 1032: 1029: 1023: 1022: 1019: 1016: 1010: 1007: 1001: 1000: 997: 994: 987: 984: 978: 977: 974: 971: 969: 966: 960: 959: 956: 953: 951: 948: 942: 941: 939: 936: 934: 931: 925: 924: 922: 920: 905: 902: 896: 895: 892: 889: 887: 884: 878: 877: 874: 872: 870: 867: 861: 860: 858: 856: 854: 851: 845: 844: 842: 839: 837: 834: 828: 827: 824: 821: 814: 812: 806: 805: 802: 799: 792: 790: 784: 783: 780: 778: 767: 765: 759: 758: 755: 752: 747:13% (29/223) ( 745: 743: 737: 736: 733: 730: 708: 705: 699: 698: 691: 688: 684:, 1.8% (1/56) 678: 675: 669: 668: 667:El Sibai 2009 665: 662: 655: 653: 647: 646: 643: 640: 638: 635: 624: 623: 620: 617: 615: 612: 601: 600: 598: 595: 593: 590: 579: 578: 575: 572: 570: 567: 561: 560: 557: 554: 552: 549: 543: 542: 539: 536: 530: 524: 514: 511: 495:Haplogroup IJK 439:mass migration 357:Ust'-Ishim man 347:(K-M2308) and 334: 328: 300: 297: 286:Czech Republic 235:haplogroup IJK 214: 213: 210: 206: 205: 195: 191: 190: 185: 181: 180: 175: 171: 170: 165: 161: 160: 155: 151: 150: 142: 141: 133: 132: 92:The article's 91: 89: 82: 75: 74: 49: 47: 40: 26: 24: 14: 13: 10: 9: 6: 4: 3: 2: 9306: 9295: 9292: 9291: 9289: 9267: 9264: 9258: 9255: 9251: 9249: 9244: 9242: 9237: 9230: 9227: 9221: 9218: 9212: 9209: 9203: 9200: 9196: 9192: 9186: 9183: 9177: 9174: 9168: 9165: 9159: 9156: 9150: 9147: 9143: 9142: 9135: 9132: 9127: 9123: 9119: 9115: 9111: 9107: 9104:(2): 187–91. 9103: 9099: 9092: 9089: 9084: 9076: 9073: 9071: 9068: 9067: 9063: 9055: 9053: 9048: 9042: 9039: 9032: 9025: 9020: 9015: 9009: 9003: 8997: 8995: 8993: 8982: 8973: 8966: 8961: 8951: 8942: 8935: 8931: 8925: 8923: 8916: 8909: 8902: 8893: 8887: 8886: 8878: 8873: 8872: 8864: 8859: 8858: 8852: 8847: 8839: 8830: 8825: 8824: 8818: 8815: 8810: 8804: 8801: 8796: 8790: 8787: 8782: 8776: 8773: 8766: 8757: 8749: 8742: 8739: 8734: 8727: 8722: 8716: 8713: 8708: 8702: 8699: 8694: 8688: 8685: 8679: 8672: 8669: 8663: 8656: 8652: 8646: 8639: 8635: 8629: 8622: 8618: 8611: 8606: 8596: 8593:February 2021 8584: 8579: 8570: 8569: 8564: 8560: 8552: 8547: 8545: 8540: 8538: 8533: 8532: 8529: 8523: 8522: 8517: 8515: 8512: 8510: 8509: 8504: 8501: 8499: 8495: 8492: 8489: 8487: 8484: 8482: 8479: 8477: 8474: 8472: 8469: 8468: 8464: 8460: 8457: 8455: 8452: 8450: 8447: 8445: 8442: 8440: 8437: 8435: 8432: 8430: 8427: 8425: 8422: 8421: 8417: 8413: 8410: 8407: 8403: 8400: 8397: 8394: 8390: 8387: 8384: 8381: 8378: 8375: 8372: 8370: 8367: 8365: 8362: 8359: 8356: 8355: 8351: 8346: 8337: 8333: 8329: 8325: 8320: 8315: 8311: 8307: 8303: 8296: 8293: 8288: 8284: 8279: 8274: 8270: 8266: 8262: 8258: 8255:(4): 161054. 8254: 8250: 8246: 8239: 8236: 8231: 8227: 8222: 8217: 8212: 8207: 8203: 8199: 8196:(3): e34288. 8195: 8191: 8187: 8179: 8176: 8171: 8165: 8161: 8154: 8151: 8146: 8142: 8138: 8137: 8129: 8126: 8121: 8117: 8113: 8109: 8105: 8101: 8097: 8093: 8089: 8082: 8079: 8071: 8064: 8057: 8055: 8053: 8049: 8044: 8040: 8036: 8032: 8027: 8022: 8018: 8014: 8010: 8003: 8000: 7995: 7991: 7987: 7983: 7978: 7973: 7969: 7965: 7961: 7953: 7950: 7945: 7941: 7937: 7933: 7929: 7925: 7921: 7917: 7913: 7909: 7905: 7901: 7897: 7889: 7886: 7881: 7877: 7872: 7867: 7862: 7857: 7853: 7849: 7845: 7841: 7837: 7830: 7827: 7822: 7818: 7813: 7808: 7804: 7800: 7796: 7792: 7788: 7784: 7780: 7773: 7770: 7765: 7761: 7757: 7753: 7748: 7743: 7739: 7735: 7731: 7724: 7722: 7718: 7713: 7709: 7703: 7700: 7695: 7691: 7687: 7683: 7679: 7675: 7671: 7667: 7663: 7659: 7651: 7648: 7645: 7640: 7637: 7632: 7628: 7624: 7620: 7615: 7610: 7606: 7602: 7598: 7591: 7588: 7583: 7579: 7575: 7571: 7567: 7563: 7559: 7555: 7547: 7544: 7538: 7535: 7524:on 2016-10-10 7523: 7519: 7513: 7510: 7505: 7501: 7496: 7491: 7487: 7483: 7480:(1): 128–37. 7479: 7475: 7471: 7464: 7461: 7456: 7452: 7447: 7442: 7438: 7434: 7430: 7423: 7420: 7414: 7411: 7405: 7402: 7396: 7393: 7387: 7384: 7379: 7375: 7371: 7367: 7363: 7359: 7355: 7351: 7347: 7343: 7339: 7332: 7329: 7324: 7320: 7316: 7312: 7308: 7304: 7297: 7294: 7288: 7285: 7280: 7276: 7271: 7266: 7261: 7256: 7252: 7248: 7245:(7): e41803. 7244: 7240: 7236: 7229: 7226: 7220: 7217: 7211: 7208: 7202: 7199: 7193: 7190: 7184: 7181: 7175: 7172: 7166: 7164: 7160: 7154: 7152: 7148: 7142: 7139: 7133: 7130: 7124: 7121: 7115: 7112: 7106: 7103: 7097: 7094: 7088: 7085: 7079: 7076: 7070: 7067: 7062: 7058: 7053: 7048: 7044: 7040: 7037:(4): 661–82. 7036: 7032: 7028: 7021: 7018: 7012: 7010: 7006: 7000: 6997: 6992: 6988: 6984: 6980: 6973: 6970: 6962: 6956: 6942:on 2017-01-20 6938: 6931: 6925: 6922: 6917: 6913: 6909: 6905: 6901: 6897: 6893: 6889: 6885: 6881: 6877: 6870: 6867: 6862: 6858: 6853: 6848: 6844: 6840: 6836: 6829: 6826: 6821: 6817: 6813: 6809: 6805: 6801: 6793: 6790: 6785: 6779: 6776: 6770: 6767: 6756: 6749: 6743: 6740: 6735: 6731: 6726: 6721: 6717: 6713: 6709: 6705: 6701: 6697: 6693: 6686: 6683: 6677: 6674: 6671: 6665: 6662: 6656: 6653: 6647: 6645: 6643: 6641: 6639: 6637: 6635: 6633: 6631: 6629: 6627: 6625: 6623: 6619: 6614: 6610: 6605: 6600: 6595: 6590: 6586: 6582: 6578: 6571: 6568: 6563: 6557: 6554: 6549: 6545: 6540: 6535: 6530: 6525: 6521: 6517: 6514:(3): e56779. 6513: 6509: 6505: 6498: 6495: 6490: 6484: 6480: 6476: 6472: 6468: 6464: 6457: 6454: 6449: 6445: 6440: 6435: 6431: 6427: 6424:(6): 820–30. 6423: 6419: 6412: 6405: 6403: 6399: 6394: 6390: 6385: 6380: 6376: 6372: 6368: 6361: 6359: 6357: 6353: 6350: 6345: 6342: 6336: 6334: 6330: 6319:on 2016-11-12 6318: 6314: 6308: 6305: 6293: 6292:www.jogg.info 6286: 6280: 6278: 6276: 6272: 6261:on 2016-10-11 6260: 6256: 6250: 6247: 6241: 6239: 6237: 6235: 6233: 6229: 6223: 6221: 6219: 6217: 6213: 6208: 6204: 6199: 6194: 6189: 6184: 6180: 6176: 6173:(3): e34288. 6172: 6168: 6164: 6157: 6154: 6149: 6145: 6140: 6135: 6131: 6127: 6122: 6117: 6113: 6109: 6106:(3): e34288. 6105: 6101: 6097: 6090: 6087: 6081: 6078: 6067:on 2017-01-18 6063: 6059: 6055: 6051: 6047: 6043: 6039: 6035: 6031: 6024: 6016: 6014: 6012: 6008: 6002: 6000: 5998: 5994: 5989: 5985: 5980: 5975: 5971: 5967: 5964:(2): 247–60. 5963: 5959: 5955: 5948: 5945: 5940: 5934: 5931: 5926: 5922: 5917: 5912: 5908: 5904: 5900: 5896: 5892: 5888: 5884: 5880: 5876: 5872: 5868: 5861: 5858: 5846:on 2016-10-03 5845: 5841: 5835: 5833: 5829: 5824: 5820: 5816: 5812: 5808: 5804: 5800: 5796: 5789: 5786: 5782: 5775: 5772: 5767: 5763: 5759: 5755: 5751: 5747: 5743: 5739: 5735: 5731: 5724: 5721: 5709: 5705: 5699: 5696: 5691: 5687: 5682: 5677: 5673: 5669: 5664: 5659: 5655: 5651: 5647: 5639: 5636: 5632: 5626: 5623: 5618: 5614: 5610: 5606: 5602: 5598: 5591: 5588: 5583: 5579: 5574: 5569: 5565: 5561: 5556: 5551: 5547: 5543: 5539: 5535: 5531: 5524: 5521: 5510: 5506: 5500: 5497: 5492: 5488: 5483: 5478: 5474: 5470: 5466: 5462: 5458: 5450: 5447: 5442: 5438: 5433: 5428: 5424: 5420: 5416: 5412: 5408: 5404: 5400: 5393: 5390: 5385: 5381: 5376: 5371: 5366: 5361: 5357: 5353: 5350:(7): e41252. 5349: 5345: 5341: 5334: 5332: 5328: 5323: 5319: 5314: 5309: 5305: 5301: 5297: 5293: 5289: 5282: 5280: 5276: 5271: 5267: 5262: 5257: 5253: 5249: 5245: 5241: 5237: 5233: 5229: 5222: 5220: 5218: 5214: 5209: 5205: 5198: 5195: 5190: 5186: 5181: 5176: 5172: 5168: 5164: 5160: 5156: 5148: 5146: 5144: 5140: 5133: 5128: 5124: 5122: 5118: 5114: 5110: 5106: 5102: 5097: 5096:10400.13/3045 5092: 5087: 5082: 5078: 5074: 5070: 5065: 5062: 5058: 5048:on 2012-12-17 5044: 5040: 5036: 5032: 5028: 5023: 5018: 5015:(7): 535–42. 5014: 5010: 5003: 4998: 4997: 4992: 4988: 4985: 4983: 4980: 4978: 4975: 4973: 4970: 4968: 4965: 4963: 4960: 4958: 4955: 4953: 4950: 4949: 4945: 4943: 4941: 4940:Bosnian Croat 4937: 4933: 4929: 4925: 4921: 4917: 4913: 4909: 4905: 4901: 4897: 4893: 4889: 4881: 4873: 4867: 4864: 4861: 4858: 4857: 4856: 4850: 4848: 4846: 4842: 4837: 4835: 4831: 4827: 4823: 4819: 4815: 4811: 4806: 4802: 4801:Ryazan Oblast 4798: 4794: 4790: 4786: 4782: 4778: 4774: 4770: 4766: 4762: 4758: 4754: 4750: 4749:genetic drift 4746: 4742: 4738: 4730: 4728: 4726: 4723:(50–60%) and 4722: 4718: 4714: 4705: 4698: 4696: 4694: 4690: 4685: 4682: 4679:in Spain and 4678: 4674: 4670: 4666: 4662: 4658: 4654: 4649: 4647: 4643: 4636: 4634: 4632: 4628: 4624: 4621:, previously 4620: 4615: 4607: 4605: 4603: 4599: 4595: 4591: 4586: 4584: 4581:and northern 4580: 4576: 4572: 4568: 4564: 4560: 4555: 4547: 4545: 4543: 4538: 4535: 4533: 4529: 4525: 4521: 4517: 4512: 4510: 4506: 4502: 4498: 4493: 4491: 4483: 4481: 4480: 4469: 4466: 4457: 4456: 4454: 4449: 4442: 4437: 4436: 4434: 4433: 4431: 4426: 4413: 4412: 4410: 4409: 4407: 4406: 4404: 4403: 4401: 4396: 4395: 4393: 4392: 4390: 4389: 4388:I2a2a1c Z161 4387: 4380: 4379: 4377: 4374: 4373: 4371: 4364: 4361: 4360: 4358: 4357: 4356:I2a2a1a M284 4355: 4354: 4352: 4351: 4349: 4348: 4346: 4341: 4334: 4333: 4331: 4328: 4327: 4325: 4320: 4319: 4317: 4316: 4314: 4313: 4311: 4310: 4308: 4307: 4303: 4298: 4291: 4290: 4288: 4281: 4280: 4278: 4273: 4267:I1a2a1d1 L803 4266: 4265: 4263: 4260: 4257: 4252: 4247: 4246: 4244: 4243: 4241: 4240: 4238: 4237: 4235: 4234: 4232: 4225: 4222: 4216:I1a1b3a1 L296 4215: 4214: 4212: 4211: 4209: 4206: 4203: 4202: 4200: 4195: 4194: 4192: 4191: 4189: 4188: 4186: 4185: 4184: 4182: 4177: 4176: 4172: 4168: 4162: 4161: 4157: 4156: 4155: 4151: 4148: 4147: 4146: 4145: 4144:FamilyTreeDNA 4141: 4137: 4129: 4123: 4121: 4118: 4114: 4110: 4106: 4102: 4098: 4094: 4090: 4088: 4086: 4085: 4081: 4079: 4076: 4074: 4072: 4071: 4067: 4065: 4062: 4058: 4054: 4050: 4046: 4042: 4038: 4034: 4030: 4028: 4026: 4025: 4021: 4019: 4016: 4012: 4008: 4004: 4000: 3996: 3992: 3988: 3986: 3984: 3983: 3979: 3977: 3974: 3970: 3966: 3962: 3958: 3954: 3950: 3946: 3942: 3938: 3934: 3932: 3930: 3929: 3925: 3923: 3920: 3916: 3912: 3908: 3904: 3900: 3896: 3892: 3888: 3884: 3880: 3876: 3872: 3870: 3868: 3867: 3864:Nasidze 2005 3863: 3860: 3857: 3853: 3851: 3849: 3846: 3845: 3841: 3838: 3836: 3833: 3831: 3828: 3827: 3823: 3820: 3818: 3815: 3813: 3810: 3809: 3805: 3802: 3799: 3795: 3791: 3788: 3786: 3783: 3782: 3778: 3775: 3773: 3770: 3768: 3765: 3764: 3760: 3757: 3755: 3752: 3750: 3747: 3746: 3742: 3739: 3737: 3734: 3732: 3729: 3728: 3724: 3721: 3718: 3714: 3710: 3706: 3702: 3698: 3695: 3693: 3690: 3689: 3686: 3683: 3681: 3678: 3676: 3673: 3672: 3668: 3666: 3664: 3661: 3659: 3656: 3655: 3652: 3649: 3646: 3644: 3642: 3639: 3638: 3634: 3631: 3629: 3626: 3624: 3621: 3620: 3617: 3614: 3611: 3609: 3607: 3604: 3603: 3600: 3598: 3595: 3591: 3587: 3584: 3582: 3579: 3578: 3574: 3571: 3569: 3566: 3564: 3561: 3560: 3556: 3553: 3550: 3547:), 37 (North 3546: 3542: 3538: 3534: 3530: 3527: 3525: 3522: 3521: 3517: 3515: 3512: 3510: 3508: 3505: 3504: 3500: 3498: 3495: 3493: 3491: 3488: 3487: 3484:Karlsson2006 3483: 3480: 3477: 3473: 3469: 3466: 3464: 3461: 3460: 3457: 3455: 3452: 3448: 3446: 3444: 3441: 3440: 3436: 3433: 3430: 3426: 3422: 3419: 3417: 3414: 3413: 3409: 3406: 3403: 3399: 3396: 3394: 3391: 3390: 3386: 3383: 3381: 3378: 3376: 3373: 3372: 3368: 3365: 3362: 3360: 3358: 3355: 3354: 3350: 3347: 3345: 3341: 3338: 3335: 3333: 3330: 3329: 3325: 3322: 3318: 3316: 3314: 3311: 3310: 3306: 3304: 3301: 3297: 3294: 3292: 3289: 3288: 3285: 3282: 3280: 3277: 3275: 3272: 3271: 3267: 3265: 3263: 3260: 3258: 3255: 3254: 3250: 3248: 3245: 3241: 3237: 3233: 3229: 3225: 3221: 3217: 3216:Bashkortostan 3213: 3209: 3205: 3201: 3197: 3195: 3192: 3191: 3187: 3184: 3182:), 0 (Mezen) 3181: 3177: 3175: 3173: 3170: 3169: 3165: 3162: 3160: 3157: 3155: 3152: 3151: 3147: 3144: 3141: 3137: 3133: 3130: 3128: 3125: 3124: 3120: 3118: 3115: 3111: 3107: 3105: 3103: 3100: 3099: 3095: 3092: 3090: 3087: 3085: 3082: 3081: 3077: 3074: 3071: 3067: 3063: 3059: 3056: 3054: 3051: 3050: 3046: 3043: 3041: 3038: 3036: 3033: 3032: 3028: 3025: 3023: 3020: 3018: 3015: 3014: 3010: 3007: 3004: 3000: 2996: 2992: 2989: 2987: 2984: 2983: 2980: 2977: 2975: 2972: 2970: 2967: 2966: 2962: 2960: 2957: 2953: 2949: 2946: 2944: 2941: 2940: 2936: 2933: 2931: 2928: 2926: 2923: 2922: 2919: 2916: 2914: 2911: 2909: 2906: 2905: 2901: 2898: 2896: 2893: 2891: 2888: 2887: 2884:Varzari 2006 2883: 2881: 2878: 2876: 2874: 2871: 2870: 2866: 2863: 2861: 2858: 2856: 2853: 2852: 2848: 2845: 2842: 2838: 2836: 2834: 2831: 2830: 2827:Noevski 2010 2826: 2823: 2820: 2816: 2812: 2809: 2807: 2804: 2803: 2800:Pericic 2005 2799: 2796: 2793: 2789: 2787: 2785: 2782: 2781: 2777: 2774: 2771: 2768: 2766: 2763: 2762: 2759: 2756: 2754: 2751: 2749: 2746: 2745: 2741: 2739: 2737: 2734: 2732: 2729: 2728: 2725: 2722: 2720: 2717: 2715: 2712: 2711: 2707: 2704: 2702: 2699: 2697: 2694: 2693: 2690: 2687: 2684: 2680: 2676: 2673: 2671: 2668: 2667: 2664: 2662: 2659: 2656: 2654: 2651: 2650: 2647: 2645: 2643: 2640: 2638: 2635: 2634: 2630: 2628: 2625: 2621: 2617: 2615: 2613: 2610: 2609: 2605: 2602: 2600: 2597: 2595: 2592: 2591: 2588:Nasidze 2005 2587: 2584: 2581: 2577: 2573: 2571: 2569: 2566: 2565: 2561: 2558: 2555: 2551: 2549: 2547: 2544: 2543: 2539: 2536: 2533: 2531: 2529: 2526: 2525: 2521: 2518: 2516: 2513: 2511: 2508: 2507: 2504:Pericic 2005 2503: 2500: 2498: 2495: 2493: 2490: 2489: 2486: 2483: 2481: 2478: 2476: 2473: 2472: 2468: 2465: 2463: 2460: 2457: 2456: 2453: 2450: 2448: 2445: 2443: 2439: 2438: 2434: 2431: 2428: 2424: 2420: 2418: 2416: 2413: 2412: 2408: 2405: 2403: 2400: 2398: 2395: 2394: 2391:Gaetano 2008 2390: 2388: 2385: 2381: 2379: 2377: 2374: 2373: 2370: 2368: 2365: 2361: 2359: 2357: 2354: 2353: 2349: 2346: 2343: 2339: 2335: 2331: 2327: 2325: 2323: 2320: 2319: 2316:Messina 2015 2315: 2313: 2310: 2306: 2302: 2298: 2296: 2294: 2291: 2290: 2286: 2283: 2280: 2276: 2272: 2268: 2264: 2260: 2256: 2253: 2251: 2248: 2247: 2243: 2240: 2237: 2233: 2229: 2225: 2222: 2220: 2217: 2216: 2212: 2210: 2207: 2203: 2201: 2199: 2196: 2195: 2192:Capelli 2003 2191: 2189: 2186: 2182: 2180: 2178: 2175: 2174: 2171:Cappeli 2013 2170: 2167: 2165: 2162: 2160: 2157: 2156: 2152: 2149: 2147: 2144: 2142: 2139: 2138: 2134: 2131: 2129: 2126: 2124: 2121: 2120: 2116: 2113: 2111: 2108: 2106: 2103: 2102: 2098: 2095: 2092: 2088: 2084: 2080: 2076: 2072: 2068: 2064: 2060: 2057: 2055: 2052: 2051: 2047: 2044: 2042: 2039: 2037: 2034: 2033: 2029: 2026: 2024: 2021: 2019: 2016: 2015: 2012: 2009: 2006: 2004: 2002: 1999: 1998: 1994: 1991: 1988: 1984: 1980: 1977: 1975: 1972: 1971: 1968: 1965: 1963: 1960: 1958: 1955: 1954: 1951: 1948: 1945: 1941: 1939: 1937: 1934: 1933: 1929: 1926: 1924: 1921: 1919: 1916: 1915: 1911: 1908: 1906: 1903: 1901: 1898: 1897: 1894:Sanchez 2004 1893: 1890: 1888: 1885: 1883: 1880: 1879: 1876:Zalloua 2008 1875: 1872: 1869: 1867: 1864: 1863: 1859: 1856: 1853: 1849: 1845: 1841: 1837: 1833: 1829: 1825: 1821: 1817: 1813: 1811: 1808: 1807: 1803: 1800: 1797: 1793: 1789: 1787: 1784: 1783: 1779: 1776: 1773: 1769: 1766: 1764: 1761: 1760: 1756: 1753: 1750: 1746: 1742: 1738: 1735: 1733: 1730: 1729: 1725: 1722: 1720: 1717: 1715: 1712: 1711: 1707: 1704: 1702: 1699: 1697: 1694: 1693: 1690:Varzari 2006 1689: 1686: 1684: 1681: 1679: 1676: 1675: 1671: 1668: 1665: 1661: 1657: 1653: 1650: 1648: 1645: 1644: 1640: 1637: 1634: 1630: 1626: 1622: 1619: 1617: 1614: 1613: 1609: 1607: 1604: 1600: 1596: 1592: 1590: 1588: 1585: 1584: 1580: 1577: 1574: 1573:Northern Savo 1570: 1567: 1565: 1562: 1561: 1558: 1555: 1553: 1550: 1547: 1544: 1543: 1539: 1536: 1534: 1531: 1529: 1526: 1525: 1521: 1518: 1515: 1511: 1507: 1504: 1502: 1499: 1498: 1494: 1491: 1489: 1486: 1484: 1481: 1480: 1476: 1473: 1471: 1468: 1466: 1463: 1462: 1459: 1456: 1454: 1451: 1449: 1446: 1445: 1441: 1438: 1436: 1433: 1431: 1428: 1427: 1423: 1420: 1418: 1415: 1413: 1410: 1409: 1405: 1402: 1400: 1397: 1395: 1392: 1391: 1388: 1385: 1383: 1380: 1377: 1374: 1373: 1369: 1366: 1364: 1361: 1359: 1356: 1355: 1351: 1348: 1346: 1343: 1341: 1338: 1337: 1333: 1330: 1327: 1323: 1319: 1315: 1311: 1307: 1304: 1302: 1299: 1298: 1294: 1291: 1289: 1286: 1284: 1281: 1280: 1276: 1273: 1270: 1266: 1262: 1258: 1254: 1250: 1247: 1245: 1242: 1241: 1237: 1234: 1232: 1229: 1227: 1224: 1223: 1219: 1216: 1214: 1211: 1209: 1206: 1205: 1201: 1198: 1196: 1193: 1191: 1188: 1187: 1183: 1180: 1177: 1173: 1171: 1169: 1166: 1165: 1161: 1158: 1156: 1153: 1151: 1148: 1147: 1143: 1140: 1137: 1133: 1129: 1125: 1121: 1118: 1116: 1113: 1112: 1108: 1105: 1102: 1098: 1094: 1092: 1090: 1087: 1086: 1083:Pericic 2005 1082: 1079: 1076: 1072: 1071:Siroki Brijeg 1068: 1064: 1061: 1059: 1056: 1055: 1051: 1048: 1045: 1041: 1037: 1033: 1030: 1028: 1025: 1024: 1020: 1017: 1014: 1011: 1008: 1006: 1003: 1002: 998: 995: 992: 988: 985: 983: 980: 979: 975: 972: 970: 967: 965: 962: 961: 957: 954: 952: 949: 947: 944: 943: 940: 937: 935: 932: 930: 927: 926: 923: 921: 918: 914: 910: 906: 903: 901: 898: 897: 893: 890: 888: 885: 883: 880: 879: 875: 873: 871: 868: 866: 863: 862: 859: 857: 855: 852: 850: 847: 846: 843: 840: 838: 835: 833: 830: 829: 825: 822: 819: 815: 813: 811: 808: 807: 803: 800: 797: 793: 791: 789: 786: 785: 781: 779: 776: 772: 768: 766: 764: 761: 760: 756: 753: 750: 746: 744: 742: 739: 738: 734: 731: 729: 725: 721: 717: 713: 709: 706: 704: 701: 700: 696: 692: 689: 687: 683: 679: 676: 674: 671: 670: 666: 663: 660: 659:Hazara people 656: 654: 652: 649: 648: 644: 641: 639: 636: 633: 629: 626: 625: 621: 618: 616: 613: 610: 606: 603: 602: 599: 596: 594: 591: 588: 584: 581: 580: 576: 573: 571: 568: 566: 563: 562: 558: 555: 553: 550: 548: 545: 544: 540: 537: 534: 531: 528: 525: 522: 521: 518: 512: 510: 508: 504: 500: 496: 491: 488: 484: 480: 476: 471: 468: 466: 461: 459: 455: 451: 447: 442: 440: 436: 432: 428: 427:Haplogroup F* 424: 423:Paglicci Cave 420: 415: 412: 408: 404: 400: 395: 393: 389: 385: 381: 376: 374: 370: 366: 362: 358: 354: 350: 346: 325: 321: 316: 310: 305: 298: 296: 294: 289: 287: 283: 279: 274: 272: 268: 264: 260: 254: 252: 248: 244: 240: 236: 232: 231:haplogroup IJ 228: 224: 220: 211: 207: 204: 200: 196: 192: 189: 186: 182: 179: 176: 172: 169: 166: 162: 159: 156: 152: 148: 143: 138: 129: 126: 118: 108: 105:and read the 104: 98: 95: 90: 81: 80: 71: 61: 57: 53: 50:This article 48: 39: 38: 33: 19: 9266: 9257: 9247: 9240: 9235: 9229: 9220: 9211: 9202: 9185: 9176: 9167: 9158: 9149: 9140: 9134: 9101: 9097: 9091: 9082: 8947: 8890: 8822: 8590: 8582: 8520: 8506: 8399:Map of 'I1c' 8386:Map of 'I1b' 8380:Map of 'I1a' 8309: 8305: 8295: 8252: 8248: 8238: 8193: 8189: 8178: 8159: 8153: 8140: 8135: 8128: 8095: 8091: 8081: 8070:the original 8016: 8012: 8002: 7967: 7963: 7952: 7903: 7899: 7888: 7843: 7839: 7829: 7786: 7782: 7772: 7737: 7733: 7711: 7702: 7661: 7657: 7650: 7639: 7604: 7600: 7590: 7557: 7553: 7546: 7537: 7526:. Retrieved 7522:the original 7512: 7477: 7473: 7463: 7436: 7432: 7422: 7413: 7404: 7395: 7386: 7345: 7341: 7331: 7306: 7302: 7296: 7287: 7242: 7238: 7228: 7219: 7210: 7201: 7192: 7183: 7174: 7141: 7132: 7123: 7114: 7105: 7096: 7087: 7078: 7069: 7034: 7030: 7020: 6999: 6982: 6978: 6972: 6944:. Retrieved 6937:the original 6924: 6883: 6879: 6869: 6842: 6838: 6828: 6803: 6799: 6792: 6778: 6769: 6758:. Retrieved 6754: 6742: 6699: 6695: 6685: 6676: 6664: 6655: 6584: 6580: 6570: 6556: 6511: 6507: 6497: 6470: 6466: 6456: 6421: 6417: 6374: 6370: 6344: 6321:. Retrieved 6317:the original 6307: 6296:. Retrieved 6291: 6263:. Retrieved 6259:the original 6249: 6170: 6166: 6156: 6103: 6099: 6089: 6080: 6069:. Retrieved 6062:the original 6033: 6029: 5961: 5957: 5947: 5933: 5874: 5870: 5860: 5848:. Retrieved 5844:the original 5798: 5794: 5788: 5780: 5774: 5733: 5729: 5723: 5712:. Retrieved 5710:. 2016-05-11 5707: 5698: 5653: 5649: 5638: 5625: 5600: 5590: 5540:(1): 21931. 5537: 5533: 5523: 5512:. Retrieved 5508: 5499: 5464: 5460: 5449: 5406: 5402: 5392: 5347: 5343: 5298:(5): 830–8. 5295: 5291: 5235: 5231: 5207: 5197: 5162: 5158: 5076: 5072: 5050:. Retrieved 5043:the original 5012: 5008: 4892:Dinaric Alps 4885: 4854: 4838: 4753:Lower Saxony 4741:Fennoscandia 4736: 4734: 4712: 4711: 4686: 4677:Castile-León 4657:Castile-León 4650: 4641: 4640: 4622: 4618: 4617: 4590:Fennoscandia 4587: 4558: 4557: 4539: 4536: 4530:(1/30), and 4513: 4494: 4489: 4487: 4478: 4477: 4450:I2a2a2 L1228 4375:I2a2a1b1 P78 4304: 4282:I1a2b1 Z2541 4261:I1a2a1c L573 4210:I1a1b3 L287 4178: 4164: 4158: 4153: 4149: 4133: 3980:Vazari 2006 3945:Piatra Neamț 3921:in Piteşti) 3824:Rootsi 2004 3779:Rootsi 2004 3743:Rootsi 2004 3575:Rootsi 2004 3533:Kristianstad 3518:Rootsi 2004 3307:Rootsi 2004 3268:Rootsi 2004 3251:Rootsi 2004 3166:Rootsi 2004 3110:Tiszavasvari 3078:Beleza 2005 3047:Rootsi 2004 3029:Rootsi 2004 3011:Kayser 2005 2778:Fendri 2015 2708:Rootsi 2004 2562:Gragni 2012 2522:Kutuev 2007 2435:Flores 2005 2213:Rootsi 2004 2185:Rush, Dublin 2153:Rootsi 2004 2117:Rootsi 2004 2099:Grugni 2012 2030:Rootsi 2004 1912:Rootsi 2004 1882:Greenlanders 1824:Thessaloniki 1780:Rootsi 2004 1757:Kayser 2005 1708:Rootsi 2004 1672:Kari Hauhio 1610:Rootsi 2004 1495:Rootsi 2004 1477:Rootsi 2004 1406:Altena 2020 1352:Rootsi 2004 1202:Rootsi 2004 1190:Central Asia 976:Kutuev 2007 710:2.6% (2/77) 694: 680:3.3% (2/60) 532: 526: 516: 513:Distribution 503:Haplogroup F 492: 472: 469: 462: 458:Haplogroup R 450:Haplogroup G 443: 431:Haplogroup C 416: 403:Haplogroup C 396: 377: 369:Goyet Q116-1 355:), such as: 342: 290: 275: 255: 237:. Subclades 222: 219:Haplogroup I 218: 217: 121: 115:January 2023 112: 101:Please help 96: 94:lead section 68:January 2016 65: 55: 51: 7309:: e48–e49. 6985:: 347–349. 5482:10256/23099 4977:Aurignacian 4908:Herzegovina 4888:Herzegovina 4579:Scandinavia 4528:Tabassarans 4516:Andalusians 4458:I2a2b1 L533 4315:I2a1 P37.2 4292:I1a3a L1237 4274:I1a2a2 Z382 4258:I1a2a1b Z73 4207:I1a1b2 L205 4204:I1a1b1 P109 4193:I1a1a M227 4167:Scandinavia 4101:Khakassians 3926:Bosch 2006 3883:Macedonians 3647:33 (China) 3557:FTDNA 2016 3501:Rootsi2004 3437:Adams 2008 3410:Vakar 2010 2963:Dupuy 2005 2833:Macedonians 2815:Macedonians 2806:Macedonians 2784:Macedonians 2731:Lithuanians 2309:Vallepietra 1944:North India 1522:FTDNA 2016 1238:Mrsic 2012 1220:Balanovsky 1005:Belarusians 982:Belarusians 894:Balanovsky 876:FTDNA 2013 826:Bosch 2006 782:Ferri 2010 757:Sarno 2015 703:Afghanistan 673:Afghanistan 651:Afghanistan 523:Population 485:and/or the 407:Magdalenian 380:Middle East 365:Kostenki 14 309:Cro-Magnons 293:Gravettians 261:and ethnic 259:Mazandarani 253:countries. 194:Descendants 8312:: 81–100. 7644:ISOGG 2011 7528:2016-10-08 7348:: 102767. 6946:2016-10-08 6760:2019-06-07 6323:2016-10-09 6298:2019-06-07 6265:2016-10-08 6071:2016-10-09 5714:2020-12-15 5656:(1): 650. 5603:: 685404. 5514:2020-12-15 5134:References 5052:2005-12-08 4987:Gravettian 4952:Haplogroup 4841:Sardinians 4699:I2a1b-M423 4646:Sardinians 4524:Slovenians 4497:Lak people 4196:I1a1a1 M72 3907:Aromanians 3891:Aromanians 3785:Ukrainians 3767:Ukrainians 3393:Slovenians 3053:Portuguese 3035:Portuguese 2943:Norwegians 2677:10 (North 2612:Kyrgyzstan 2415:Jordanians 2397:Jordanians 2267:Val di Non 1918:Hungarians 1900:Hungarians 1376:Darginians 1358:Darginians 1334:Luca 2007 1150:Bulgarians 1115:Bulgarians 609:Cherkessia 565:Abkhazians 547:Abazinians 435:Mesolithic 399:Gravettian 307:Spread of 9248:PhyloTree 9083:Footnotes 8328:1570-677X 8035:1476-5438 7986:0960-9822 7928:1476-4687 7803:0002-9297 7756:1434-5161 7712:isogg.org 7678:0340-6717 7378:251658864 7362:1872-4973 6900:0340-6717 6716:1469-1809 6479:1310-1331 6130:1932-6203 5907:0028-0836 5850:5 October 5708:Genetiker 5672:2399-3642 5617:198249005 5564:2045-2322 5491:1476-4687 4843:, and in 4731:I2a2-M436 4637:I2a1a-M26 4594:haplotype 4567:Satakunta 4540:A living 4522:(4/179), 4518:(3/103), 4136:subclades 4130:Subgroups 4117:Tuvinians 4057:Ossetians 4049:Ossetians 4007:Lithuania 3957:Moldovans 3949:Moldovans 3937:Romanians 3919:Romanians 3915:Constanta 3911:Romanians 3875:Albanians 3675:Tunisians 3658:Tunisians 3545:Stockholm 3541:Kronoberg 3416:Spaniards 3220:Chuvashes 3154:Romanians 3127:Romanians 2908:Moroccans 2890:Moroccans 2873:Moldovans 2841:Albanians 2819:Albanians 2458:Karachays 2301:Filettino 2063:Armenians 1796:Macedonia 1772:Macedonia 1714:Georgians 1696:Georgians 1660:Strasburg 1528:Estonians 1465:Estonians 1448:Egyptians 1430:Egyptians 929:Ashkenazi 900:Austrians 865:Armenians 832:Algerians 810:Albanians 788:Albanians 763:Albanians 741:Albanians 454:Neolithic 318:European 284:from the 9288:Category 9245:, and; 9236:op. cit. 9126:23291764 9118:24166809 8756:F-Y27277 8494:Archived 8418:Projects 8402:Archived 8389:Archived 8336:25190282 8287:28484621 8230:22470552 8190:PLOS ONE 8120:36632274 8112:16266413 8043:16724001 7994:19781941 7936:26062507 7880:24204668 7840:PLOS ONE 7821:15162323 7764:19911015 7694:10763736 7686:14586639 7631:32079904 7623:18294359 7582:23156886 7574:16759179 7504:15162323 7455:16724001 7370:36037736 7323:28789900 7279:22848614 7239:PLOS ONE 7061:15024688 6955:cite web 6916:11066186 6908:15959808 6861:85134429 6820:16644145 6734:19686289 6613:35722696 6548:23483890 6508:PLOS ONE 6489:21359873 6448:19107149 6393:15944443 6207:22470552 6167:PLOS ONE 6148:22470552 6100:PLOS ONE 6058:27204150 6050:15180701 5988:12858290 5925:27135931 5823:11073453 5758:19661421 5690:33159107 5582:33318530 5441:27135931 5384:22815981 5344:PLOS ONE 5322:18385274 5270:27135931 5189:15162323 5105:12825075 5039:15822710 5031:12825075 4946:See also 4936:Serbians 4904:Sarajevo 4814:Bithynia 4797:Moldavia 4781:Provence 4765:Normandy 4761:Scotland 4757:Cornwall 4721:Dalmatia 4693:obsidian 4665:Pyrenees 4631:Sardinia 4602:Italians 4588:Outside 4563:Germanic 4534:(1/35). 4526:(2/55), 4501:Dagestan 4299:I1b Z131 4181:Anatolia 4113:Tofalars 4041:Iranians 4033:Iranians 3969:Gagauzes 3961:Gagauzes 3830:Yemenese 3709:Anatolia 3705:Istanbul 3590:Lausanne 3549:Norrland 3476:Varmland 3443:Sudanese 3425:Asturias 3321:Portugal 3313:Sephardi 3291:Scotland 3240:Cossacks 3236:Mordvins 3232:Belgorod 3228:Smolensk 3224:Kostroma 3172:Russians 3003:Szczecin 2969:Pakistan 2696:Lebanese 2679:Maronite 2670:Lebanese 2653:Latvians 2568:Kurmanji 2427:Dead Sea 2376:Italians 2356:Italians 2338:Picenium 2322:Italians 2293:Italians 2259:Calabria 2250:Italians 2228:Sardinia 2219:Italians 2206:Sardinia 2198:Italians 2087:Khorasan 2071:Persians 2054:Iranians 2036:Iranians 2018:Iranians 2001:Iranians 1983:Khorasan 1974:Iranians 1848:Ioannina 1844:Karditsa 1828:Mytilene 1678:Gagauzes 1629:Brittany 1625:Auvergne 1595:Normandy 1548:Belgians 1510:Cornwall 1378:(Kaitak) 1269:Varaždin 1208:Chechens 1168:Bulgaria 1101:Bosniaks 1040:Bosniaks 726:, 0/127 724:Pashtuns 720:Turkmens 632:Kabardia 487:Caucasus 483:Anatolia 263:Persians 184:Ancestor 8960:K-M2313 8953: 8894: 8879: 8865: 8849: 8840: 8831: 8653: 8636: 8583:updated 8505:, from 8278:5414258 8257:Bibcode 8221:3314501 8198:Bibcode 7944:4399103 7908:Bibcode 7871:3799995 7848:Bibcode 7812:1181996 7495:1181996 7270:3404992 7247:Bibcode 7052:1181943 6748:"Photo" 6725:3312577 6604:9284021 6539:3590186 6516:Bibcode 6439:2947100 6198:3314501 6175:Bibcode 6139:3314501 6108:Bibcode 5979:1180365 5916:4943878 5879:Bibcode 5803:Bibcode 5795:Science 5766:1324559 5738:Bibcode 5730:Science 5681:7648643 5601:bioRxiv 5573:7736346 5542:Bibcode 5432:4943878 5411:Bibcode 5375:3399854 5352:Bibcode 5313:2336805 5261:4943878 5240:Bibcode 5180:1181996 5125:ISOGG, 5113:2834639 4924:Swedish 4845:Hazaras 4818:Galatia 4785:Tuscany 4708:(2017). 4673:Basques 4669:Maghreb 4627:Balkans 4608:I2-M438 4583:Germany 4548:I1-M253 4105:Todjins 4097:Teleuts 4055:), 13 ( 4047:), 32 ( 4045:Isfahan 4039:), 10 ( 4037:Teheran 4015:Estonia 4013:), 17 ( 4005:), 12 ( 4003:Karelia 4001:), 18 ( 3997:), 28 ( 3993:), 41 ( 3967:), 31 ( 3955:), 24 ( 3947:), 35 ( 3917:), 39 ( 3905:), 42 ( 3897:), 19 ( 3895:Krusevo 3889:), 21 ( 3881:), 29 ( 3796:), 23 ( 3703:), 10 ( 3701:Marmara 3641:Tataers 3623:Syrians 3606:Syrians 3592:), 32 ( 3543:), 55 ( 3539:), 59 ( 3535:), 60 ( 3472:Gotland 3451:Nubians 3429:Gascony 3375:Slovaks 3242:), 24 ( 3238:), 23 ( 3234:), 19 ( 3230:), 17 ( 3226:), 11 ( 3222:), 19 ( 3200:Udmurts 3138:), 18 ( 3068:), 18 ( 3066:Setubal 3001:), 22 ( 2997:), 12 ( 2925:Mongols 2855:Maltese 2817:), 12 ( 2765:Libyans 2748:Libyans 2620:Uyghurs 2594:Kuwaiti 2580:Georgia 2475:Kazakhs 2384:Caccamo 2364:Stelvio 2336:), 13 ( 2332:), 17 ( 2307:), 28 ( 2277:), 19 ( 2263:Pescara 2083:Isfahan 2075:Teheran 2067:Teheran 1987:Teheran 1936:Indians 1846:), 8 ( 1842:), 12 ( 1838:), 11 ( 1836:Larissa 1834:), 14 ( 1830:), 14 ( 1826:), 18 ( 1822:), 20 ( 1820:Agrinio 1818:), 24 ( 1794:), 30 ( 1749:Leipzig 1747:), 15 ( 1745:Hamburg 1743:), 32 ( 1732:Germans 1662:), 10 ( 1658:), 18 ( 1627:), 13 ( 1603:Corsica 1564:Finland 1546:Flemish 1512:), 38 ( 1501:English 1483:English 1324:), 10 ( 1316:), 15 ( 1312:), 25 ( 1310:Klatovy 1267:), 29 ( 1263:), 57 ( 1259:), 41 ( 1255:), 52 ( 1136:Haskovo 1134:), 10 ( 1132:Plovdiv 1130:), 30 ( 1126:), 32 ( 1099:), 45 ( 1042:), 33 ( 1038:), 49 ( 1013:Polesie 991:Polesie 964:Balkars 911:), 29 ( 749:Albania 722:, 0/87 718:, 0/74 541:Source 479:Balkans 411:Azilian 382:and/or 299:Origins 225:) is a 9195:K-M526 9124: 9116: 8983: 8979: 8974: 8962: 8943: 8770: 8762: 8758: 8753: 8334: 8326: 8285: 8275: 8228: 8218: 8166: 8118: 8110: 8041: 8033: 7992: 7984: 7942: 7934: 7926: 7900:Nature 7878: 7868: 7819: 7809: 7801: 7762: 7754: 7692: 7684: 7676: 7629: 7621: 7580: 7572: 7502: 7492: 7453: 7376: 7368: 7360: 7321: 7277: 7267: 7059: 7049: 6914: 6906: 6898: 6859: 6818: 6732: 6722: 6714: 6611: 6601: 6546: 6536: 6486: 6477: 6446: 6436: 6391: 6294:. 2008 6205: 6195: 6146: 6136: 6128: 6056: 6048: 5986: 5976: 5923: 5913: 5905: 5871:Nature 5821: 5764: 5756: 5688: 5678: 5670: 5615: 5580: 5570: 5562: 5489: 5461:Nature 5439: 5429: 5403:Nature 5382: 5372: 5320: 5310: 5268: 5258: 5232:Nature 5187: 5177: 5111: 5103: 5037: 5029: 4932:Danish 4920:German 4912:Croats 4900:Bosnia 4882:Height 4830:Thrace 4793:Latium 4791:, and 4789:Umbria 4777:Perche 4775:, and 4663:, the 4659:, the 4598:French 4542:Hazara 4520:French 4505:Adygea 4484:I-M170 4306:I-M438 4160:I-M253 4150:I-M170 4140:Y-Full 4115:), 1 ( 4109:Evenks 4107:), 2 ( 4103:), 3 ( 4099:), 4 ( 4095:), 4 ( 4061:Digora 4011:Latvia 4009:), 7 ( 3991:Sweden 3973:Kongaz 3965:Etulia 3941:Buhusi 3903:Thrace 3899:Greeks 3887:Skopje 3879:Tirana 3856:Turkey 3715:), 0 ( 3711:), 4 ( 3537:Kalmar 3524:Swedes 3507:Swedes 3490:Swedes 3474:& 3463:Swedes 3427:), 0 ( 3344:Kosovo 3340:Serbia 3274:Saudis 3244:Adygea 3218:), 7 ( 3214:), 6 ( 3212:Tatars 3210:), 5 ( 3206:), 5 ( 3204:Pinega 3202:), 5 ( 3193:Russia 3136:Brasov 3112:), 5 ( 3102:Romani 3064:), 0 ( 3062:Lisboa 2999:Lublin 2995:Warsaw 2956:Bergen 2792:Skopje 2714:Lezgis 2681:), 0 ( 2624:Kyrgyz 2622:), 0 ( 2578:), 0 ( 2576:Turkey 2510:Kumyks 2442:Nogays 2425:), 0 ( 2342:Latini 2340:), 7 ( 2334:Saniti 2303:) 35 ( 2279:Foggia 2271:Verona 2269:), 5 ( 2236:Marche 2232:Umbria 2230:), 4 ( 2123:Iraqis 2105:Iraqis 2069:), 0 ( 1985:), 0 ( 1957:Ingush 1865:Greeks 1850:), 2 ( 1840:Patrai 1816:Serres 1809:Greeks 1792:Athens 1785:Greeks 1763:Greeks 1741:Berlin 1647:French 1631:), 9 ( 1616:French 1601:), 4 ( 1597:), 4 ( 1587:French 1326:Třebíč 1320:) 14 ( 1301:Czechs 1283:Cyprus 1257:Osijek 1244:Croats 1226:Croats 1097:Croats 1075:Zenica 1067:Mostar 1036:Croats 915:), 6 ( 909:Vienna 818:Tirana 796:Tirana 773:), 4 ( 728:Uzbeks 716:Tajiks 712:Hazara 707:0.99% 695:et al. 693:Haber 682:Hazara 628:Adyghe 605:Adyghe 587:Adygea 583:Adyghe 452:among 384:Europe 361:Oase 1 336: 330: 178:Europe 18:I-M170 9122:S2CID 8772:GHIJK 8465:Other 8139:[ 8116:S2CID 8073:(PDF) 8066:(PDF) 7940:S2CID 7690:S2CID 7627:S2CID 7578:S2CID 7374:S2CID 6940:(PDF) 6933:(PDF) 6912:S2CID 6857:S2CID 6751:(PNG) 6483:INIST 6414:(PDF) 6288:(PDF) 6065:(PDF) 6054:S2CID 6026:(PDF) 5762:S2CID 5613:S2CID 5109:S2CID 5046:(PDF) 5035:S2CID 5005:(PDF) 4993:Notes 4928:Dutch 4826:Gauls 4773:Anjou 4769:Maine 4681:Béarn 4532:Saami 4183:at 1% 4111:) 3 ( 4093:Kizhi 4059:from 4053:Ardon 4051:from 4043:from 4035:from 3971:from 3963:from 3953:Sofia 3951:from 3939:from 3848:Zazas 3812:Welsh 3731:Turks 3692:Turks 3581:Swiss 3563:Swiss 3554:1800 3434:1002 3366:1200 3357:Serbs 3342:with 3332:Serbs 3283:1597 3257:Saami 3185:1228 3180:Unzha 3114:Tokaj 3084:Qatar 3070:Braga 3017:Poles 2986:Poles 2546:Kurds 2528:Kurds 2440:Kara 2423:Amman 2330:Udine 2275:Genoa 2273:), 7( 2177:Irish 2159:Irish 2141:Irish 1852:Chios 1832:Crete 1754:1215 1656:Paris 1519:1830 1514:Essex 1412:Dutch 1403:2085 1394:Dutch 1340:Danes 1314:Písek 1265:Split 1235:1100 1128:Sofia 1124:Varna 1119:27-29 1044:Serbs 946:Azeri 938:1099 917:Tyrol 882:Avars 849:Andis 697:2012 686:Tajik 677:1.5% 529:hg I 373:Krems 278:Italy 265:from 9114:PMID 8941:K2b1 8786:HIJK 8678:A1b1 8634:A0-T 8332:PMID 8324:ISSN 8283:PMID 8226:PMID 8164:ISBN 8108:PMID 8039:PMID 8031:ISSN 7990:PMID 7982:ISSN 7932:PMID 7924:ISSN 7876:PMID 7817:PMID 7799:ISSN 7760:PMID 7752:ISSN 7682:PMID 7674:ISSN 7619:PMID 7570:PMID 7500:PMID 7451:PMID 7366:PMID 7358:ISSN 7319:PMID 7275:PMID 7057:PMID 6983:1261 6961:link 6904:PMID 6896:ISSN 6816:PMID 6800:Gene 6730:PMID 6712:ISSN 6609:PMID 6544:PMID 6475:ISSN 6444:PMID 6389:PMID 6203:PMID 6144:PMID 6126:ISSN 6046:PMID 5984:PMID 5921:PMID 5903:ISSN 5852:2016 5819:PMID 5754:PMID 5686:PMID 5668:ISSN 5578:PMID 5560:ISSN 5487:ISSN 5437:PMID 5380:PMID 5318:PMID 5266:PMID 5185:PMID 5101:PMID 5027:PMID 4816:and 4803:and 4747:and 4629:and 4600:and 4509:Iraq 4169:and 4142:and 4134:The 4031:34 ( 3989:38 ( 3943:and 3935:47 ( 3873:17 ( 3854:33 ( 3821:196 3803:701 3794:Sumy 3792:33 ( 3776:585 3758:164 3740:741 3722:523 3699:12 ( 3684:601 3632:554 3615:520 3594:Bern 3588:13 ( 3572:144 3531:60 ( 3481:305 3423:18 ( 3407:458 3400:57 ( 3384:250 3348:209 3298:17 ( 3208:Komi 3163:361 3145:178 3140:Cluj 3134:36 ( 3075:657 3044:303 3026:191 3008:913 2993:19 ( 2978:638 2952:Oslo 2950:40 ( 2934:160 2917:760 2899:316 2839:13 ( 2824:343 2813:31 ( 2790:34 ( 2775:175 2688:951 2683:Shia 2637:Laks 2585:112 2574:17 ( 2554:Iran 2501:114 2484:370 2432:146 2406:273 2382:31 ( 2362:30 ( 2347:583 2328:23 ( 2299:36 ( 2284:524 2241:884 2226:31 ( 2183:11 ( 2168:119 2132:117 2114:176 2096:952 2091:Yazd 2079:Fars 2010:324 1992:186 1966:143 1949:560 1927:230 1909:162 1891:215 1873:142 1857:366 1814:36 ( 1801:149 1790:10 ( 1777:261 1770:30 ( 1739:32 ( 1669:333 1664:Lyon 1654:11 ( 1638:555 1599:Lyon 1578:536 1556:113 1537:118 1508:12 ( 1492:945 1474:194 1457:370 1439:124 1421:410 1398:27.8 1386:101 1349:194 1331:257 1318:Brno 1308:25 ( 1292:164 1274:518 1261:Pula 1253:Hvar 1251:55 ( 1217:330 1199:984 1174:19 ( 1159:100 1122:40 ( 1106:255 1095:73 ( 1080:210 1049:256 1034:73 ( 1018:204 996:565 973:135 913:Graz 907:50 ( 891:115 841:156 775:Gheg 771:Tosk 769:16 ( 754:223 732:507 690:204 619:126 597:154 569:33.3 429:and 409:and 267:Fars 249:and 241:and 223:M170 197:I*, 9106:doi 9024:P1a 9019:P1b 9014:P1c 9002:NO1 8930:K2a 8922:K2b 8915:K2c 8908:K2d 8901:K2e 8795:IJK 8668:A1b 8662:A1a 8628:A00 8314:doi 8273:PMC 8265:doi 8216:PMC 8206:doi 8100:doi 8021:doi 7972:doi 7916:doi 7904:522 7866:PMC 7856:doi 7807:PMC 7791:doi 7742:doi 7666:doi 7662:114 7609:doi 7562:doi 7490:PMC 7482:doi 7441:doi 7350:doi 7311:doi 7265:PMC 7255:doi 7047:PMC 7039:doi 6987:doi 6888:doi 6884:117 6847:doi 6808:doi 6804:376 6720:PMC 6704:doi 6599:PMC 6589:doi 6534:PMC 6524:doi 6434:PMC 6426:doi 6379:doi 6193:PMC 6183:doi 6134:PMC 6116:doi 6038:doi 5974:PMC 5966:doi 5911:PMC 5895:hdl 5887:doi 5875:534 5811:doi 5799:290 5746:doi 5734:325 5676:PMC 5658:doi 5605:doi 5568:PMC 5550:doi 5477:hdl 5469:doi 5465:615 5427:PMC 5419:doi 5407:534 5370:PMC 5360:doi 5308:PMC 5300:doi 5256:PMC 5248:doi 5236:534 5175:PMC 5167:doi 5091:hdl 5081:doi 5017:doi 4828:of 4759:), 4623:I1b 4499:of 4179:In 4091:2 ( 3913:in 3901:in 3893:in 3885:in 3877:in 3861:27 3839:62 3789:28 3771:22 3749:UAE 3650:33 3585:23 3528:44 3449:5 ( 3397:30 3379:28 3336:39 3326:57 3319:4 ( 3295:11 3261:31 3198:2 ( 3158:22 3131:28 3093:72 3060:3 ( 3021:18 2947:37 2864:90 2859:12 2846:64 2797:79 2757:83 2723:81 2705:66 2641:14 2618:0 ( 2603:42 2559:59 2552:2 ( 2537:21 2519:73 2466:69 2451:76 2421:5 ( 2257:0 ( 2223:10 2163:10 2150:76 2145:11 2073:of 2065:of 2061:6 ( 2045:92 2027:83 1942:0 ( 1922:28 1904:23 1886:17 1767:14 1736:24 1723:77 1705:63 1687:89 1651:13 1623:5 ( 1568:29 1551:28 1505:26 1487:18 1469:19 1367:26 1344:49 1305:18 1181:63 1141:935 1062:65 955:72 904:28 823:30 816:7 ( 801:55 664:60 657:3 ( 642:59 574:12 556:88 551:3.4 345:K2a 320:LGM 9290:: 9238:; 9120:. 9112:. 9102:35 9100:. 8992:P1 8877:J2 8871:J1 8863:I2 8857:I1 8846:K2 8838:LT 8809:IJ 8765:F3 8748:F1 8712:CF 8707:DE 8698:CT 8684:BT 8651:A1 8645:A0 8619:" 8330:. 8322:. 8310:15 8308:. 8304:. 8281:. 8271:. 8263:. 8251:. 8247:. 8224:. 8214:. 8204:. 8192:. 8188:. 8114:. 8106:. 8096:69 8094:. 8090:. 8051:^ 8037:. 8029:. 8017:14 8015:. 8011:. 7988:. 7980:. 7968:19 7966:. 7962:. 7938:. 7930:. 7922:. 7914:. 7902:. 7898:. 7874:. 7864:. 7854:. 7842:. 7838:. 7815:. 7805:. 7797:. 7787:75 7785:. 7781:. 7758:. 7750:. 7738:54 7736:. 7732:. 7720:^ 7710:. 7688:. 7680:. 7672:. 7660:. 7625:. 7617:. 7605:72 7603:. 7599:. 7576:. 7568:. 7558:70 7556:. 7498:. 7488:. 7478:75 7476:. 7472:. 7449:. 7437:14 7435:. 7431:. 7372:. 7364:. 7356:. 7346:61 7344:. 7340:. 7317:. 7307:31 7305:. 7273:. 7263:. 7253:. 7241:. 7237:. 7162:^ 7150:^ 7055:. 7045:. 7035:74 7033:. 7029:. 7008:^ 6981:. 6957:}} 6953:{{ 6910:. 6902:. 6894:. 6882:. 6878:. 6855:. 6841:. 6837:. 6814:. 6802:. 6753:. 6728:. 6718:. 6710:. 6700:73 6698:. 6694:. 6621:^ 6607:. 6597:. 6585:63 6583:. 6579:. 6542:. 6532:. 6522:. 6510:. 6506:. 6481:. 6471:62 6469:. 6465:. 6442:. 6432:. 6422:17 6420:. 6416:. 6401:^ 6387:. 6375:22 6373:. 6369:. 6355:^ 6332:^ 6290:. 6274:^ 6231:^ 6215:^ 6201:. 6191:. 6181:. 6169:. 6165:. 6142:. 6132:. 6124:. 6114:. 6102:. 6098:. 6052:. 6044:. 6034:68 6032:. 6028:. 6010:^ 5996:^ 5982:. 5972:. 5962:73 5960:. 5956:. 5919:. 5909:. 5901:. 5893:. 5885:. 5873:. 5869:. 5831:^ 5817:. 5809:. 5797:. 5760:. 5752:. 5744:. 5732:. 5706:. 5684:. 5674:. 5666:. 5652:. 5648:. 5611:. 5599:. 5576:. 5566:. 5558:. 5548:. 5538:10 5536:. 5532:. 5507:. 5485:. 5475:. 5463:. 5459:. 5435:. 5425:. 5417:. 5405:. 5401:. 5378:. 5368:. 5358:. 5346:. 5342:. 5330:^ 5316:. 5306:. 5296:18 5294:. 5290:. 5278:^ 5264:. 5254:. 5246:. 5234:. 5230:. 5216:^ 5206:. 5183:. 5173:. 5163:75 5161:. 5157:. 5142:^ 5107:. 5099:. 5089:. 5077:75 5075:. 5071:. 5033:. 5025:. 5013:11 5011:. 5007:. 4787:, 4771:, 4767:, 4655:, 4119:) 4063:) 4017:) 3858:) 3834:0 3816:8 3800:) 3753:0 3735:5 3719:) 3696:5 3679:0 3662:0 3627:2 3596:) 3567:8 3478:) 3467:42 3431:) 3420:6 3404:) 3323:) 3302:) 3278:0 3246:) 3142:) 3088:0 3072:) 3057:8 3039:5 3005:) 2990:17 2958:) 2929:1 2912:0 2894:0 2843:) 2821:) 2810:24 2794:) 2772:1 2769:2 2752:0 2735:7 2700:5 2685:) 2674:3 2657:9 2626:) 2598:0 2582:) 2556:) 2496:8 2446:13 2429:) 2401:1 2386:) 2366:) 2344:) 2311:) 2281:) 2261:, 2254:7 2238:) 2234:, 2208:) 2187:) 2127:1 2109:1 2093:) 2089:, 2085:, 2081:, 2077:, 2058:0 2040:1 2022:0 1989:) 1978:2 1946:) 1854:) 1798:) 1774:) 1751:) 1700:0 1682:28 1666:) 1635:) 1620:9 1605:) 1575:) 1532:17 1516:) 1452:1 1434:0 1416:33 1362:58 1328:) 1287:1 1271:) 1248:47 1230:45 1194:2 1178:) 1154:34 1138:) 1077:) 1069:, 1046:) 1031:53 1009:32 986:23 933:1 919:) 886:2 869:5 853:27 836:0 820:) 798:) 777:) 751:) 661:) 637:10 509:. 465:I1 353:BP 349:C1 324:BP 273:. 243:I2 239:I1 203:I2 201:, 199:I1 188:IJ 9128:. 9108:: 9052:Q 9047:R 9038:O 9031:N 8981:M 8972:S 8950:P 8892:T 8885:L 8829:J 8823:I 8814:K 8800:H 8781:G 8738:F 8733:C 8726:E 8721:D 8693:B 8615:" 8595:) 8591:( 8585:. 8550:e 8543:t 8536:v 8338:. 8316:: 8289:. 8267:: 8259:: 8253:4 8232:. 8208:: 8200:: 8194:7 8172:. 8122:. 8102:: 8045:. 8023:: 7996:. 7974:: 7946:. 7918:: 7910:: 7882:. 7858:: 7850:: 7844:8 7823:. 7793:: 7766:. 7744:: 7714:. 7696:. 7668:: 7633:. 7611:: 7584:. 7564:: 7531:. 7506:. 7484:: 7457:. 7443:: 7380:. 7352:: 7325:. 7313:: 7281:. 7257:: 7249:: 7243:7 7063:. 7041:: 6993:. 6989:: 6963:) 6949:. 6918:. 6890:: 6863:. 6849:: 6843:2 6822:. 6810:: 6786:. 6763:. 6736:. 6706:: 6615:. 6591:: 6564:. 6550:. 6526:: 6518:: 6512:8 6491:. 6450:. 6428:: 6395:. 6381:: 6326:. 6301:. 6268:. 6209:. 6185:: 6177:: 6171:7 6150:. 6118:: 6110:: 6104:7 6074:. 6040:: 5990:. 5968:: 5927:. 5897:: 5889:: 5881:: 5854:. 5825:. 5813:: 5805:: 5768:. 5748:: 5740:: 5717:. 5692:. 5660:: 5654:3 5633:」 5619:. 5607:: 5584:. 5552:: 5544:: 5517:. 5493:. 5479:: 5471:: 5443:. 5421:: 5413:: 5386:. 5362:: 5354:: 5348:7 5324:. 5302:: 5272:. 5250:: 5242:: 5191:. 5169:: 5115:. 5093:: 5083:: 5055:. 5019:: 2973:0 2718:0 2514:0 2479:1 2461:9 1961:0 1718:4 1381:0 1212:0 968:3 950:3 634:) 630:( 614:2 611:) 607:( 592:7 589:) 585:( 533:% 527:% 499:K 326:. 221:( 128:) 122:( 117:) 113:( 109:. 99:. 70:) 66:( 34:. 20:)

Text is available under the Creative Commons Attribution-ShareAlike License. Additional terms may apply.

Index