Knowledge (XXG)

Talk:DNA and RNA codon tables

Source 📝

1232:
what forms hydrogen bonds with the AUG of the mRNA transcript formed by RNA polymerase. The ATG on the opposite strand stores information, in a way, but doesn't actually participate. I just found this kind of ambiguous. If the polymerase acted on ATG, it would form the complementary strand UAC, which would code for a different amino acid, tyrosine, rather than methionine. Here is the Met-tRNA, from 5' to 3', I think (it never said, and I'm pretty sure I assumed it was 3' to 5'): AGTAAGGTCAGCTAAATAAGCTATCGGGCC CAT ACCCCGAAAATGTTGGTTATACCCTTCCCGTACTA. If RNA polymerase acts on that sequence, the tRNA created would be UCAUUCCAGUCGAUUUAUUCGAUAGCCCGG GUA UGGGGCUUUUACAACCAAUAUGGGAAGGGCAUGAU, but apparently this is wrong, and I need to "just replace T with U" because it's sense, rather than the antisense template that I've been assuming... And the final tRNA is really AGUAAGGUCAGCUAAAUAAGCUAUCGGGCC CAU ACCCCGAAAAUGUUGGUUAUACCCUUCCCGUACUA, which does have the anticodon for the correct mRNA codon, AUG, but the original DNA that made that sequence still had to be TAC, but if I translated again to get the sense version, it would be ATG. So I guess I've been making things harder for myself this whole time, assuming I needed to find the complementary strand to find an mRNA transcript, when all I need to do is "replace T with U" because we're biased toward 5' to 3'? The thing is, I've read DNA and translated it to RNA and then proteins, using TAC as a start codon and ATT/ATC/ACT as end codons, since those are what are complementary to the AUG start codon and UAA/UAG/UGA end codons in RNA. If I had used ATG (Tyr) as a start codon and TAA/TAG/TGA(Ile/Thr) as end codons, I would have got a completely different set of proteins. And I have the entire antisense DNA codon chart memorized (as well as the sense RNA codon chart), apparently. --
579: 499: 471: 203: 555: 332: 240: 629: 611: 1144:
difference being Uracil versus Thymin anyway. Isn't there a standard body that has recommended which way to go about? By the way, the DNA codon table is what I found first via google, so perhaps other people also are led first to this page, rather than the RNA codon table, in particular because there is no standalone RNA codon table on wikipedia, so there is bias created towards this page here.
394: 384: 363: 303: 1125:, and is explicitly listed in the See Also section. If you go to a page explicitly titled DNA..., that's what you would find here. If you wound up here by following a link where it really should be pointing to the RNA case, feel free to let us know, or even alter the link yourself to help others find what makes the most sense in context. 1194:. Either I'm going crazy or someone really messed up on this codon chart, probably because they just decided to take the RNA chart and replace U with T. Again, TAC should be start and ATT/ATC/ACT should be stop. (Edit: Apparently I am going crazy and have always been using antisense and making things more difficult for myself) -- 965:
It is rather confusing for visitors, including myself, why there are now both RNA codon tables and DNA codon tables. I was so used to a RNA codon table, since that is the one that is read by the ribosome on the mRNA, and now the page seems to arbitrarily claim that the DNA codon table is more proper.
872:
The topic of the page is supposed to be relatively technical. While it's not rocket science, it is also not meant for anyone who doesn't know anything about basic molecular biology. Anyway, I redid the context. If someone disagrees with the way that is written, then he/she is welcomed to edit it. And
1249:
Well, perhaps, but that translation is only appropriate if the "genetic code" is actually for a sequence of amino acids; there are plenty of non-coding sequences. Or was this a subtle piece of wording, so it's only a "code" if it does code for a sequence, as opposed to all the other functions of DNA
1231:
Yeah, I realized that. Apparently I've been using 3' to 5' arbitrarily unknowingly for a while now. But I still think there should be an antisense version of the table available, since the antisense strand is what is actually used as a template for the mRNA, and the antisense codon (TAC, not ATG) is
1143:
Not much is "explained" in the intro sentence at all, it merely claims that it is that way. I agree with the poster before me, it simply is confusing as it is. Why are there now two different codon tables? Also, a bit aside from the point, translating from one to the other is trivial due to the only
704:
This page is created because people might deem a RNA codon table to be more appropriate than a DNA codon table in the "Genetic Code" page. However, since a DNA codon table is generally more convenient for people who work with genomic data, then it may be preferred to have this table stored somewhere
1181:
Since the start codon is AUG in RNA, wouldn't it be TAC in DNA, not ATG? Bases have to form hydrogen bonds to pair. G doesn't bond with G. Believe it or not, you can't ONLY swap U for T, because U bonds with A and A bonds with T / T bonds with A, while C bonds to G and G bonds to C. Similarly, the
756:
it. While merging this to another page is definitely appropriate, the way that you've accomplished that is not very appropriate by my standards. To repeat myself: While the tables are nearly identical to the RNA codon tables, they also represent the genetic code in a form that's more convenient to
1340:
The second image in the introduction (the one showing the DNA double helix) is nice, but it seems incorrect if you look closely. That is, if you follow a single strand it reads GCA ACT CTA AAT TGA rather than GCA AGA GAT AAT TGT. With each turn of the helix, which strand is on top in the image
842:
It is not clear to me, and I am sufficiently unfamiliar with the subject matter to be the wrong person to improve it. And for heavens sake, look at any other wikipedia article and you'll find that it'll tend to start with an emboldened subject followed by a succinct definition. Why is this the
1120:
That it all explained in the intro sentences. It's true that "all you have to do is replace a U with a T", but having to do that (especially repeatedly, if you're looking at lots of genes) is harder than just having the result already in the table. The RNA table is at
1097:
Sorry, but this article just confuses things. I can see no advantage in having a DNA codon table. Anybody with a working knowledge of this topic will know that, for the equivalent of a codon in the coding strand of DNA, all you have to do is replace a U with a T.
816:" ... or somesuch form of words, to provide a clear definition of the table. For me, the current wording entirely fails to do that. I understand why you thik this article is important. I do not understand why the article does not make clear to me what it is. -- 1093:
Look in any molecular biology text book, and by definition a codon is found in RNA, specifically messenger RNA. A codon is not found in DNA, although an equivalent triplet sequence is found in the coding strand of a polypeptide-encoding gene.
761:
page to retrieve the table and replace uracils with thymines, I assure you that it gets tiresome after doing this for the n-th time. If you feel a strong urge to apply your wiki standards, then maybe you should start with merging/redirecting
166: 1360:
shows the wrong transcription, and I think the error is significantly misleading since it's important to the transcription process that a single strand is followed, rather than jumping between strands every half cycle.
588: 485: 1182:
end codons in RNA are UAA, UAG, and UGA, which correspond to DNA sequences of ATT, ATC, and ACT. In other words, this table is pretty messed up. The way it currently stands, it says ATG is start when ATG = UAC =
1204:
By convention, the DNA sequence of a gene is given as the "sense", "+", "non-transcribed" or "non-template" strand. This strand is complementary to the antisense strand, which is itself complementary to the
1504: 545: 282: 217: 1145: 1057: 967: 1559: 923:
The compressed codon for Glutamine is given in the table as CCR, whilst the compressed codon for Proline is CCN. These seem to conflict- I believe the codon for Glutamine should be CAR, not CCR.
1499: 1056:
No, this detail is important and it is trivial to change. The codons appliy only to mRNA, due to so many RNAs being popular these days, it would not help to denote it as mRNA rather than RNA.
980:
Thanks for the comments. I've provided a citation and re-worded the lead in an attempt to provide some clarification. I've also clarified that DNA codon tables are more common now
1529: 539: 160: 1208:
To put it another way, the 5'-AUG-3' start codon is complementary to the DNA sequence 3'-TAC-5'. But here we're giving the sequence of the other DNA strand, which is 5'-ATG-3'.
564: 481: 246: 313: 1564: 57: 515: 881:
this genetic code (i.e. DNA and RNA codon tables). Now, I hope the next criticism will come from someone who actually knows about the topic (i.e. a scientist).
92: 1524: 1378: 453: 1539: 1313:
Using this source? Absolutely not, this writing is completely unhinged. Some other image to illustrate the effect of a one-base mutation? Maybe, we have
843:
exception? And is starting with the definite article sensible? As far as I'm aware, there are at least two genetic codes, one for RNA and one for DNA. --
569: 506: 476: 1574: 1514: 673: 443: 679: 98: 1158:
I'm not sure there's much we can do about the way Google works, but I've added an additional link to the RNA codon table in the first sentence.
1544: 1554: 1519: 593: 708:
Potentially, this page can be merged to a short reference page for bioinformatics where tables of general amino acid properties are stored.
419: 924: 43: 1579: 1534: 1105: 1149: 1061: 971: 649: 181: 1509: 148: 112: 117: 33: 578: 1459: 1423: 1398: 1325: 1215: 410: 368: 87: 1569: 730: 343: 1549: 645: 641: 636: 616: 222: 78: 142: 1341:
switches. Thus, if someone is looking closely to understand how the codons would be found in DNA, they may get confused.
1445: 309: 212: 138: 1448:
extracted from the article so we could see and update them in a central place. We should get that arrangement back.
239: 122: 1211: 188: 1314: 828:
The wording seems clear enough to me. However, feel free to change the introduction if you can make it better.
37: 928: 349: 226: 1381:, I think I'll attempt to either repair or re-create this image, but I won't have time for at least a week. 1346: 1255: 1109: 1029: 863: 331: 202: 1101: 68: 1219: 1159: 1071: 1044: 1025: 1022: 989: 943: 900: 886: 859: 856: 847: 833: 820: 791: 713: 514:
on Knowledge (XXG). If you would like to participate, please visit the project page, where you can join
83: 1269:
Hello I want to suggest a 3D version of the RNA to better understand the relationships of the codons.
154: 1455: 1441: 1419: 1321: 1250:
sequences? If so, it really does need explanation, as that sort of thing would pass by many readers.
727: 302: 230: 1406: 1386: 1366: 738: 174: 966:
I can't find any links or articles discussing this, so perhaps more links could be added, please?
726:, as suggested in the AfD discussion, since all the relevant information already exists there. -- 1342: 1251: 1039:
Do you have a suggestion for improving the article? I think those sorts of details belong at
779: 511: 64: 1379:
Knowledge (XXG):Teahouse/Questions/Archive_1134#Advice_on_fixing_an_error_in_an_article_image
1477: 1301: 1130: 882: 844: 829: 817: 787: 709: 1452: 1416: 1318: 1283: 1122: 988:, so hopefully there's no longer any implication that the DNA codon table is more proper. 498: 470: 1357: 1246:"A codon table can be used to translate a genetic code into a sequence of amino acids." 1402: 1382: 1362: 748:
I've taken the liberty of undoing your redirect, since that had little difference to a
399: 1186:. The end codons are also wrong. TAG and TAA translate to AUC and AUU, which code for 554: 1493: 1484: 1463: 1427: 1410: 1390: 1370: 1350: 1329: 1308: 1287: 1259: 1226: 1198: 1166: 1153: 1134: 1113: 1078: 1065: 1051: 1033: 996: 975: 950: 932: 907: 890: 867: 850: 837: 823: 795: 742: 717: 1233: 1195: 1040: 896: 809: 804:
It would help enormously if you rephrased the lead paragraph such that it started "
758: 723: 1021:
side note: By RNA it is mRNA. There are different kinds of RNA (tRNA, mRNA, ect.)
1470: 1294: 1126: 877:
known naturally-occurring genetic code but there are a number of common ways of
393: 1293:
Do you have multiple high quality reliable sources to support the addition? ~
1279: 1187: 389: 757:
most biologists. And even though it is definitely trivial to scroll down the
1191: 783: 628: 610: 1214:
sort of explains this, though it could really use a clearer diagram, like
1451:
Refs will still work if the names are managed correctly. Same for notes.
1270: 1183: 771: 763: 415: 383: 362: 767: 775: 1275:
How can my suggestion be added without upsetting all editors?
813: 325: 297: 28: 15: 577: 553: 414:, an effort to build a comprehensive and detailed guide to 648:, where you can join the project and/or contribute to the 245:
This article appeared on Knowledge (XXG)'s Main Page as
1505:
Featured lists that have appeared on the main page once
939: 752:
and as far as I know, the decision by the admin was to
275: 418:
on Knowledge (XXG). Leave messages on the WikiProject
173: 510:, a collaborative effort to improve the coverage of 1560:
WikiProject Molecular and Cellular Biology articles
187: 1500:Featured lists that have appeared on the main page 678:This article has not yet received a rating on the 544:This article has not yet received a rating on the 938:Thanks for the note. This was actually fixed in 46:for general discussion of the article's subject. 1530:Unknown-importance Molecular Biology articles 1469:I'm not sure what you're advocating for... ~ 1397:I have now replaced the erroneous image with 524:Knowledge (XXG):WikiProject Molecular Biology 8: 640:, an attempt to structure and organize all 605: 465: 357: 312:on 10 September 2010 (UTC). The result of 254: 197: 722:I've taken the liberty of redirecting to 589:the Molecular and Cell Biology task force 644:. If you wish to help, please visit the 1565:All WikiProject Molecular Biology pages 1146:2A02:8388:1600:6900:BE5F:F4FF:FECD:7CB2 1058:2A02:8388:1600:6900:BE5F:F4FF:FECD:7CB2 968:2A02:8388:1600:6900:BE5F:F4FF:FECD:7CB2 607: 467: 359: 527:Template:WikiProject Molecular Biology 329: 7: 1070:The current version refers to mRNA. 634:This article is within the scope of 504:This article is within the scope of 1525:FL-Class Molecular Biology articles 899:naturally-occurring genetic codes. 428:Knowledge (XXG):WikiProject Biology 348:It is of interest to the following 229:. If you can update or improve it, 36:for discussing improvements to the 1401:, correcting the problems noted. 14: 1540:High-importance Genetics articles 658:Knowledge (XXG):WikiProject Lists 63:New to Knowledge (XXG)? Welcome! 1575:Unknown-importance List articles 1515:High-importance Biology articles 1399:File:DNA translation example.jpg 627: 609: 497: 469: 392: 382: 361: 330: 301: 238: 201: 58:Click here to start a new topic. 448:This article has been rated as 308:This article was nominated for 1436:Merge with the templates again 891:18:43, 24 September 2010 (UTC) 851:22:08, 23 September 2010 (UTC) 838:19:18, 23 September 2010 (UTC) 824:17:29, 23 September 2010 (UTC) 796:01:49, 19 September 2010 (UTC) 743:09:10, 18 September 2010 (UTC) 718:20:00, 10 September 2010 (UTC) 1: 1545:WikiProject Genetics articles 1485:19:46, 21 December 2023 (UTC) 1464:05:55, 21 December 2023 (UTC) 1428:12:47, 21 December 2023 (UTC) 1411:19:26, 31 December 2021 (UTC) 1391:14:29, 15 December 2021 (UTC) 1371:01:20, 15 December 2021 (UTC) 1351:14:40, 11 November 2021 (UTC) 1330:12:52, 21 December 2023 (UTC) 1271:A 3D view of the Genetic Code 1135:17:53, 22 November 2012 (UTC) 1114:16:50, 22 November 2012 (UTC) 642:list pages on Knowledge (XXG) 586:This article is supported by 562:This article is supported by 518:and see a list of open tasks. 507:WikiProject Molecular Biology 55:Put new text under old text. 1555:High-importance MCB articles 1520:WikiProject Biology articles 1446:Template:Inverse codon table 1227:09:29, 24 October 2014 (UTC) 1199:07:06, 24 October 2014 (UTC) 1052:01:59, 16 October 2011 (UTC) 1034:17:12, 15 October 2011 (UTC) 984:, as opposed to more common 908:01:59, 16 October 2011 (UTC) 868:17:12, 15 October 2011 (UTC) 431:Template:WikiProject Biology 1415:That's a beautiful repair! 1265:3D view of the Genetic Code 1167:05:58, 15 August 2015 (UTC) 1154:17:07, 14 August 2015 (UTC) 1079:05:58, 15 August 2015 (UTC) 1066:17:08, 14 August 2015 (UTC) 997:05:58, 15 August 2015 (UTC) 976:17:05, 14 August 2015 (UTC) 1596: 1580:WikiProject Lists articles 1535:FL-Class Genetics articles 1260:17:29, 19 March 2021 (UTC) 680:project's importance scale 661:Template:WikiProject Lists 530:Molecular Biology articles 454:project's importance scale 215:, which means it has been 1510:FL-Class Biology articles 1309:01:48, 29 June 2021 (UTC) 1288:01:09, 29 June 2021 (UTC) 1212:Sense (molecular biology) 951:11:04, 5 April 2012 (UTC) 933:10:30, 5 April 2012 (UTC) 677: 622: 585: 561: 543: 492: 447: 377: 356: 257: 253: 227:Knowledge (XXG) community 93:Be welcoming to newcomers 22:Skip to table of contents 1315:File:3D Genetic Code.jpg 406:DNA and RNA codon tables 209:DNA and RNA codon tables 38:DNA and RNA codon tables 21: 565:the Genetics task force 283:Featured list candidate 1570:FL-Class List articles 1177:Incorrect translations 582: 558: 338:This article is rated 88:avoid personal attacks 1550:FL-Class MCB articles 1377:Based on feedback at 1089:Definition of a Codon 986:than RNA codon tables 942:edit a few days ago. 873:lastly, there's only 581: 557: 342:on Knowledge (XXG)'s 247:Today's featured list 113:Neutral point of view 1442:Template:Codon table 982:than they used to be 118:No original research 855:TWO for RNA???????? 411:WikiProject Biology 221:as one of the best 1356:You're right, the 1242:Well, perhaps, but 583: 559: 344:content assessment 258:Article milestones 249:on March 19, 2021. 99:dispute resolution 60: 1462: 1426: 1328: 1104:comment added by 780:natural logarithm 694: 693: 690: 689: 686: 685: 637:WikiProject Lists 604: 603: 600: 599: 521:Molecular Biology 512:Molecular Biology 477:Molecular Biology 464: 463: 460: 459: 324: 323: 296: 295: 292: 291: 196: 195: 79:Assume good faith 56: 27: 26: 1587: 1482: 1475: 1458: 1422: 1324: 1306: 1299: 1116: 812:associated with 806:DNA Codon Tables 734: 666: 665: 662: 659: 656: 631: 624: 623: 613: 606: 546:importance scale 532: 531: 528: 525: 522: 501: 494: 493: 488: 473: 466: 436: 435: 434:Biology articles 432: 429: 426: 402: 397: 396: 386: 379: 378: 373: 365: 358: 341: 335: 334: 326: 305: 298: 278: 276:January 29, 2021 255: 242: 225:produced by the 205: 198: 192: 191: 177: 108:Article policies 29: 16: 1595: 1594: 1590: 1589: 1588: 1586: 1585: 1584: 1490: 1489: 1478: 1471: 1438: 1338: 1302: 1295: 1267: 1244: 1179: 1123:RNA codon table 1099: 1091: 1019: 735: 732: 702: 663: 660: 657: 654: 653: 594:High-importance 570:High-importance 529: 526: 523: 520: 519: 479: 450:High-importance 433: 430: 427: 424: 423: 408:is part of the 398: 391: 372:High‑importance 371: 339: 274: 134: 129: 128: 127: 104: 74: 12: 11: 5: 1593: 1591: 1583: 1582: 1577: 1572: 1567: 1562: 1557: 1552: 1547: 1542: 1537: 1532: 1527: 1522: 1517: 1512: 1507: 1502: 1492: 1491: 1488: 1487: 1437: 1434: 1433: 1432: 1431: 1430: 1394: 1393: 1374: 1373: 1337: 1334: 1333: 1332: 1311: 1266: 1263: 1243: 1240: 1239: 1238: 1237: 1236: 1209: 1206: 1190:. TGA = ACU = 1178: 1175: 1174: 1173: 1172: 1171: 1170: 1169: 1138: 1137: 1090: 1087: 1086: 1085: 1084: 1083: 1082: 1081: 1018: 1015: 1014: 1013: 1012: 1011: 1010: 1009: 1008: 1007: 1006: 1005: 1004: 1003: 1002: 1001: 1000: 999: 925:94.173.129.198 921: 920: 919: 918: 917: 916: 915: 914: 913: 912: 911: 910: 853: 799: 798: 731: 705:in wikipedia. 701: 698: 696: 692: 691: 688: 687: 684: 683: 676: 670: 669: 667: 632: 620: 619: 614: 602: 601: 598: 597: 584: 574: 573: 560: 550: 549: 542: 536: 535: 533: 516:the discussion 502: 490: 489: 474: 462: 461: 458: 457: 446: 440: 439: 437: 404: 403: 400:Biology portal 387: 375: 374: 366: 354: 353: 347: 336: 322: 321: 314:the discussion 306: 294: 293: 290: 289: 286: 279: 271: 270: 267: 264: 260: 259: 251: 250: 243: 235: 234: 206: 194: 193: 131: 130: 126: 125: 120: 115: 106: 105: 103: 102: 95: 90: 81: 75: 73: 72: 61: 52: 51: 48: 47: 41: 25: 24: 19: 13: 10: 9: 6: 4: 3: 2: 1592: 1581: 1578: 1576: 1573: 1571: 1568: 1566: 1563: 1561: 1558: 1556: 1553: 1551: 1548: 1546: 1543: 1541: 1538: 1536: 1533: 1531: 1528: 1526: 1523: 1521: 1518: 1516: 1513: 1511: 1508: 1506: 1503: 1501: 1498: 1497: 1495: 1486: 1483: 1481: 1476: 1474: 1468: 1467: 1466: 1465: 1461: 1457: 1454: 1449: 1447: 1443: 1435: 1429: 1425: 1421: 1418: 1414: 1413: 1412: 1408: 1404: 1400: 1396: 1395: 1392: 1388: 1384: 1380: 1376: 1375: 1372: 1368: 1364: 1359: 1355: 1354: 1353: 1352: 1348: 1344: 1343:Strongyloides 1335: 1331: 1327: 1323: 1320: 1316: 1312: 1310: 1307: 1305: 1300: 1298: 1292: 1291: 1290: 1289: 1285: 1281: 1276: 1273: 1272: 1264: 1262: 1261: 1257: 1253: 1252:Chiswick Chap 1247: 1241: 1235: 1230: 1229: 1228: 1225: 1223: 1217: 1213: 1210: 1207: 1203: 1202: 1201: 1200: 1197: 1193: 1189: 1185: 1176: 1168: 1165: 1163: 1157: 1156: 1155: 1151: 1147: 1142: 1141: 1140: 1139: 1136: 1132: 1128: 1124: 1119: 1118: 1117: 1115: 1111: 1107: 1106:86.146.121.25 1103: 1095: 1088: 1080: 1077: 1075: 1069: 1068: 1067: 1063: 1059: 1055: 1054: 1053: 1050: 1048: 1042: 1038: 1037: 1036: 1035: 1031: 1027: 1026:Turtleguy1134 1024: 1023:Turtleguy1134 1016: 998: 995: 993: 987: 983: 979: 978: 977: 973: 969: 964: 963: 962: 961: 960: 959: 958: 957: 956: 955: 954: 953: 952: 949: 947: 941: 937: 936: 935: 934: 930: 926: 909: 906: 904: 898: 894: 893: 892: 888: 884: 880: 876: 871: 870: 869: 865: 861: 860:Turtleguy1134 858: 857:Turtleguy1134 854: 852: 849: 846: 841: 840: 839: 835: 831: 827: 826: 825: 822: 819: 815: 811: 807: 803: 802: 801: 800: 797: 793: 789: 785: 781: 777: 773: 769: 765: 760: 755: 751: 747: 746: 745: 744: 740: 736: 729: 725: 720: 719: 715: 711: 706: 699: 697: 681: 675: 672: 671: 668: 664:List articles 651: 647: 643: 639: 638: 633: 630: 626: 625: 621: 618: 615: 612: 608: 595: 592:(assessed as 591: 590: 580: 576: 575: 571: 568:(assessed as 567: 566: 556: 552: 551: 547: 541: 538: 537: 534: 517: 513: 509: 508: 503: 500: 496: 495: 491: 487: 483: 478: 475: 472: 468: 455: 451: 445: 442: 441: 438: 421: 417: 413: 412: 407: 401: 395: 390: 388: 385: 381: 380: 376: 370: 367: 364: 360: 355: 351: 345: 337: 333: 328: 327: 319: 315: 311: 307: 304: 300: 299: 287: 285: 284: 280: 277: 273: 272: 268: 265: 262: 261: 256: 252: 248: 244: 241: 237: 236: 232: 228: 224: 220: 219: 214: 213:featured list 210: 207: 204: 200: 199: 190: 186: 183: 180: 176: 172: 168: 165: 162: 159: 156: 153: 150: 147: 144: 140: 137: 136:Find sources: 133: 132: 124: 123:Verifiability 121: 119: 116: 114: 111: 110: 109: 100: 96: 94: 91: 89: 85: 82: 80: 77: 76: 70: 66: 65:Learn to edit 62: 59: 54: 53: 50: 49: 45: 39: 35: 31: 30: 23: 20: 18: 17: 1479: 1472: 1450: 1439: 1339: 1303: 1296: 1277: 1274: 1268: 1248: 1245: 1234:User:Zuloo37 1221: 1196:User:Zuloo37 1180: 1161: 1100:— Preceding 1096: 1092: 1073: 1046: 1041:Genetic code 1020: 991: 985: 981: 945: 922: 902: 879:representing 878: 874: 810:genetic code 808:set out the 805: 759:Genetic Code 753: 749: 724:genetic code 721: 707: 703: 695: 646:project page 635: 587: 563: 505: 449: 409: 405: 350:WikiProjects 317: 281: 231:please do so 216: 208: 184: 178: 170: 163: 157: 151: 145: 135: 107: 32:This is the 883:Bobthefish2 845:Tagishsimon 830:Bobthefish2 818:Tagishsimon 788:Bobthefish2 710:Bobthefish2 161:free images 44:not a forum 1494:Categories 1188:Isoleucine 895:There are 650:discussion 218:identified 1403:Smcpeak74 1383:Smcpeak74 1363:Smcpeak74 1336:DNA Image 1192:Threonine 1017:Side note 784:logarithm 420:talk page 101:if needed 84:Be polite 34:talk page 1278:Saludos 1184:Tyrosine 1102:unsigned 728:Radagast 700:Untitled 482:Genetics 340:FL-class 310:deletion 288:Promoted 69:get help 42:This is 40:article. 1453:Artoria 1440:We had 1417:Artoria 1319:Artoria 1220:Adrian 1160:Adrian 1072:Adrian 1045:Adrian 990:Adrian 944:Adrian 901:Adrian 897:several 772:trigram 764:unigram 452:on the 425:Biology 416:biology 369:Biology 266:Process 167:WP refs 155:scholar 1224:Hunter 1164:Hunter 1127:DMacks 1076:Hunter 1049:Hunter 994:Hunter 948:Hunter 905:Hunter 848:(talk) 821:(talk) 768:bigram 750:delete 346:scale. 269:Result 139:Google 1358:image 1280:H2mex 1205:mRNA. 776:ngram 655:Lists 617:Lists 223:lists 211:is a 182:JSTOR 143:books 97:Seek 1444:and 1407:talk 1387:talk 1367:talk 1347:talk 1284:talk 1256:talk 1216:this 1150:talk 1131:talk 1110:talk 1062:talk 1030:talk 972:talk 940:this 929:talk 887:talk 864:talk 834:talk 792:talk 754:keep 739:talk 714:talk 444:High 318:keep 316:was 263:Date 175:FENS 149:news 86:and 1480:333 1473:HAL 1456:2e5 1420:2e5 1322:2e5 1304:333 1297:HAL 875:one 814:DNA 782:to 778:or 774:to 674:??? 540:??? 486:MCB 189:TWL 1496:: 1460:🌉 1424:🌉 1409:) 1389:) 1369:) 1349:) 1326:🌉 1317:. 1286:) 1258:) 1222:J. 1218:. 1162:J. 1152:) 1133:) 1112:) 1074:J. 1064:) 1047:J. 1043:. 1032:) 992:J. 974:) 946:J. 931:) 903:J. 889:) 866:) 836:) 794:) 786:. 770:, 766:, 741:) 716:) 596:). 572:). 484:/ 480:: 169:) 67:; 1405:( 1385:( 1365:( 1345:( 1282:( 1254:( 1148:( 1129:( 1108:( 1060:( 1028:( 970:( 927:( 885:( 862:( 832:( 790:( 737:( 733:3 712:( 682:. 652:. 548:. 456:. 422:. 352:: 320:. 233:. 185:· 179:· 171:· 164:· 158:· 152:· 146:· 141:( 71:.

Index

Skip to table of contents
talk page
DNA and RNA codon tables
not a forum
Click here to start a new topic.
Learn to edit
get help
Assume good faith
Be polite
avoid personal attacks
Be welcoming to newcomers
dispute resolution
Neutral point of view
No original research
Verifiability
Google
books
news
scholar
free images
WP refs
FENS
JSTOR
TWL
Featured list
featured list
identified
lists
Knowledge (XXG) community
please do so

Text is available under the Creative Commons Attribution-ShareAlike License. Additional terms may apply.